Resultados de la búsqueda

1. Fishery Report: Exploratory fishery for Dissostichus spp. in Division 58.4.3a

   . eleginoides D. mawsoni Total 2003/04 6 0 250 0 0 0 - 0 2004/05 3 4 250 97 9 105 98 203 2005/06 4 1 250 ... has been recorded, if they are still suitable for release (i.e. still in condition 3 or 4). 6 ... ......................................................................... 3 3. Parameter estimation ................................................................... 3 ... 3.1 Observations........................................................................ 3 3.2 ...

   Document : Site Section: Publications

2. Use of the Leslie stock depletion model for the assessment of local abundance of Patagonian toothfish (Dissostichus eleginoides)

   , 14, 15, 16, 17, 18, 20, 22 3, 9, 15, 19, 22 6, 10, 14 2, 8, 9, 12 Number of Data Series with ... a Negative Slope 12 15 6 8 2 6 2 3 Number of Data Series with a Significant Ne ative ... . Series 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 2 1 22 Table 6 ... -06 2.1E-06 -2.8E-06 2.5E-06 Series 1 2 3 4 5 6 7 8 9 10 11 12 1 3 14 15 16 ...

   Science Journal Paper : CCAMLR Science, Volume 3 (CCAMLR Science, Volume 3) : 55–77 : Autor(es): Parkes, G., C.A. Moreno, G. Pilling and Z. Young

3. Fishery Report: Dissostichus eleginoides South Sandwich Islands (Subarea 48.4)

   mortality in Subarea 48.4 (from SC-CAMLR-XXVII, Annex 6, Table 3). Season Mortality rate (birds per ... (SC-CAMLR-XXVII, Annex 6, paragraph 9.10). 6 TOP 48.4 Figure 3: Positions of the ... IUU catch ........................................................................... 3 1.3 Size ... distribution of catches ........................................................ 3 2. Stocks and areas ...

   Document : Site Section: Publications

4. By-catch of fishes captured by the krill fishing vessel Chiyo Maru No. 2 in Statistical Area 58 (January to March 1995)

   T O Z U ~ ~ ~ p a 6 o ~ e AaeTCR K P ~ T K I ? ~ ~ IIOBTOPH~I& a ~ a n u 3 C O ~ ~ ~ H H ~ I X ... Haul 6 17 3 1 43 59 62 70 75 83 86 9 1 98 101 107 118 132 137 146 148 152 156 ... : Tabla 2: Tabla 3: Figura 1: Figura 2: Figura 3: Figura 4: Figura 5: Figura 6 ... CCAMLR Science, Vol. 3 (1996): 111-123 BY-CATCH OF ...

   Science Journal Paper : CCAMLR Science, Volume 3 (CCAMLR Science, Volume 3) : 111–123 : Autor(es): Watters, G

5. Sources of variance in studies of krill population genetics

   tD N A h ap lo ty pe s 70 , 6 8, 6 3, 4 8 D if fe re nt ia ti on M eg an yc ti ph ... , 1 44 , 1 44 , 9 3, 9 6, 1 44 , 9 6, 1 82 N o d if fe re nt ia ti on B uc kl in ... e t a l., 1 99 7 75 m tD N A h ap lo ty pe s* 14 , 1 2, 1 4, 1 3, 1 6, 1 8 ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Autor(es): Jarman, S.N. and S. Nicol

6. Fishery Report: Exploratory fishery for Dissostichus spp. in Subareas 88.1 and 88.2

   6 0° S TOT 88.1, 88.2 2 3. In 2010/11, the exploratory fishery for Dissostichus spp. in ... ) D. mawsoni D. eleginoides Total Korea, Republic of 6 3 77 77 New Zealand 4 3 244 244 Russia 3 ... 296 297 0 297 1999/00 - 3 2090 0 751 751 0 751 2000/01 6 10 2064 34 626 660 0 660 2001/02 10 3 2508 ... Hong Jin No. 707 17 (0) 40 (0) Jung Woo No. 3 6 (0) 35 (0) New Zealand Antarctic Chieftain ...

   Document : Site Section: Publications

7. Fishery Report: Dissostichus eleginoides South Georgia (Subarea 48.3)

   summarised in Table 3 (taken from SC-CAMLR-XXVII, Annex 6, Table 3). No new estimates of potential seabird ... and SC-CAMLR-XXVI, Annex 6, Part II, Table 20. 5 TOP 48.3 Table 3: Seabird observed mortality ... ......................................................................... 3 3. Parameters and available data.......................................................... 3 ... ............................................................... 5 6. By-catch of birds and mammals ....................................................... 5 ...

   Document : Site Section: Publications

8. Report on Bottom Fisheries and Vulnerable Marine Ecosystems

   2 6 5 4 2 3 4 2 2 30 Notifications (vessel*fishery) 2 6 25 12 7 3 4 4 2 65 Assessment submitted ... ............................................................ 2 DETAILS OF VULNERABLE MARINE ECOSYSTEMS ............................... 3 Register of VMEs ... .......................................................................... 3 VMEs present on the register and their status ........................................ 3 ... Measures to conserve registered VMEs ............................................... 3 Risk Areas ...

   Document : Site Section: Publications

9. Fishery Report: Dissostichus eleginoides Kerguelen Islands (Division 58.5.1)

   1 237 5 967 1999/00 3 046 3 093 6 139 2 600 8 739 2000/01 2 593 2 153 4 747 4 550 9 297 2001 ... /02 3 976 178 4 154 6 300 10 454 2002/03 5 291 0 5 291 5 518 10 809 2003/04 5 171 0 5 171 536 5 ... and areas ......................................................................... 3 3. Parameter ... .............................................................. 6 4. Stock assessment ........................................................................ 6 ...

   Document : Site Section: Publications

10. Fishery Report: Dissostichus eleginoides (TOP) Prince Edward Islands South African EEZ (Subareas 58.6 AND 58.7)

    distribution of catches (time series) ......................................... 3 2. Stocks and areas ... ......................................................................... 3 3. Parameter estimation ................................................................... 3 ... ............................................................... 5 6. Incidental mortality of birds and mammals ........................................... 5 ... Identification of levels of risk ..................................................... 6 6.3 Pot fishery by ...

    Document : Site Section: Publications

Páginas