Resultados de la búsqueda

1. e-sc-x.pdf

   ... this amendment to the Rules of Procedure (Annex 4). 2.3 Concerning Rule 20(a), the Executive ... Scientific Committee ANNEX 4: Proposed Amendments and Additions to Part X of the Scientific Committee ... . The report of this meeting was distributed as SC-CAMLR-X/4. 1.18 The Sixth Meeting of WG-CEMP was ... Secretary was urged to use facsimile when notifying Argentina of the draft agenda for meetings. 4 application/pdf attached to:SC-CAMLR-X

   Meeting Report : SC-CAMLR-X

2. Volume 9: CCAMLR. 1997. Statistical Bulletin, Vol. 9 (1987–1996). CCAMLR, Hobart, Australia.

   Table 2 Table 3 Table 4 Table 5 Table 6 Table 7 Table 8 Table 9 Table 10 Table 11 Table 12 ... 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Catch history of ... 14 19 21 25 29 33 37 44 51 60 69 89 93 93 94 94 95 95 96 96 by selected ... detaiL 3. Section C (Figures 4 to 11) summarises the catch histories of selected species in graphical ...

   Document : Site Section: Publications

3. Demographic characteristics of the Adélie penguin population on Béchervaise Island after 12 years of study

   63 18 80 72 0 0. 38 19 99 / 00 37 31 18 36 99 0 0. 54 20 00 / 01 35 ... 17 36 34 0. 02 19 95 / 96 35 75 18 13 72 7 0. 40 19 96 / 97 38 42 ... gg ed (m in im um a ge 4 y ea rs ) 76 54 59 30 20 28 10 25 17 30 (a ) N um be rs ... % ) 7+ 35 (4 6% ) 29 (5 4% ) 35 (5 9% ) 18 (6 0% ) 15 (7 5% ) 22 (7 9 ...

   Science Journal Paper : CCAMLR Science, Volume 10 (CCAMLR Science, Volume 10) : 53–74 : Autor(es): Clarke, J., L.M. Emmerson, A. Townsend and K.R. Kerry

4. COLLAPSE OF SOUTH AFRICA’S PENGUINS IN THE EARLY 21ST CENTURY

   from about 56 000 pairs in 2001 to some 21 000 pairs in 2009, a loss of 35 000 pairs (>60%) in eight ... 000 pairs in 2003. In the Western Cape, numbers decreased from a mean of 35 000 pairs in 2001–2005 to ...

   Meeting Document : WG-EMM-11/P8 : Autor(es): R.J.M. Crawford, R. Altwegg, B.J. Barham, P.J. Barham, J.M. Durant, B.M. Dyer, D. Geldenhuys, A.B. Makhado, L. Pichegru, P.G. Ryan, L.G. Underhill, L. Upfold, J. Visagie, L.J. Waller and P.A. Whittington

5. An impact assessment framework for bottom fishing methods in the CAMLR Convention Area

   . 2 72 3. 0 24 0 00 17 .4 4 35 1 0. 40 0. 2 0. 08 0 T ot al s (i nc lu d ... kb on e 3 61 5. 2 1 3 61 5. 2 1 00 0 3. 62 4 35 1 0. 08 3 0. 05 0. 00 ... 35 1 0. 00 00 5 0. 4 0. 00 00 21 Sc en ar io 1 : D ra gg ed d ow nl in e 47 4 ... 0. 15 71 .1 3 00 0 0. 21 4 35 1 0. 00 49 0. 8 0. 00 39 Sc en ar io 3 ...

   Science Journal Paper : CCAMLR Science, Volume 16 (CCAMLR Science, Volume 16) : 195–210 : Autor(es): Sharp, B.R., S.J. Parker and N. Smith

6. Fishery Report 2014: Exploratory fishery for Dissostichus spp. in Subareas 88.1 and 88.2

   - - 0 2000 - 0 - 0 - - 0 2001 - 0 - 0 - - 0 2002 40 4 - 0 - 20 0 2003 60 18 - 0 - 140 8 2004 60 37 ... ) 158 (4) 332 (28) 38 (1) 183 (23) 220 (25) UK Argos Georgia 50 (0) 220 (35) 182 (4) 51 (2 ... ) 20 (0) Hong Jin No. 707 17 (3) 40 (3) 38 (1) 22 (1) Jung Woo No. 3 6 (0) 35 (0 ... 426 112 133 4 7 190 160 20 2009 430 183 135 7 7 088 160 16 2010 430 119 142 8 6 796 160 15 2011 430 ...

   Document : Site Section: Publications

7. e-sc-xxv-a6.pdf

   ... was added to Item 6 and the agenda was adopted (Attachment A). 4. The list of participants is ... (Champsocephalus gunnari) (SG-ASAM-06/4). 7. WG-FSA-SFA made the following recommendations to WG-FSA (WG-FSA-03 ... in Cambridge (SG-ASAM-06/4). 8. In January 2004, a short acoustic survey off South Georgia (WG-FSA ... -SAM-04/20) showed that icefish of all age classes spend time in midwater and reinforced the evidence application/pdf attached to:SG-ASAM-06

   Meeting Report : SG-ASAM-06

8. e-sc-xxvii-a5.pdf

   ... Scientific Committee and its working groups. Work relevant to WG-FSA was highlighted (WG-FSA- 08/4) and ... fisheries were summarised in WG-FSA-08/4 in Table 2. 3.8 Three other fisheries targeting toothfish were ... Secretariat, where possible, immediately prior to the 2008 meeting (WG-FSA-08/4, Table 3). Developments ... assessments (WG-FSA-08/4, Table 4), development of an R script to plot the catch-weighted length frequencies application/pdf attached to:WG-FSA-08

   Meeting Report : WG-FSA-08

9. e-sc-v-a4.pdf

   ... ANNEX 4 REPORT OF THE AD HOC WORKING GROUP ON FISH STOCK ASSESSMENT REPORT OF THE AD HOC ... CSIRO Marine Laboratories, Battery Point, Hobart, Australia from 1–4 September 1986. Dr R.C. Hennemuth ... squares). 4. Length and age data have been reported for most species for those seasons and areas in ... Georgia (Doc. 4) and results of mesh selection experiments (Doc. 5). ASSESSMENTS General 6. Though application/pdf attached to:WG-FSA-86

   Meeting Report : WG-FSA-86

10. Low genetic diversity in the Antarctic toothfish (Dissostichus mawsoni) observed with mitochondrial and intron DNA markers

    performed in 20 μl volumes for a minimum of 4 h, following the manufacturer’s recommendations (New England ... CCGCTTAGYGCTTTGAAGGC ND3/4 AGTATAAGTGACTTCCAATCAC 50 72 2 Cronin et al., 1993 TTAGAATCACAATCTAATGTTTT COI ... AGTATAAGCGTCTGGGTAGTC 60 72 2 Palumbi et al., 1991 CCAGAGATTAGAGGGAATCAGTG COII AAAGGGAGGAATTGAACCC 50 72 2 ... TGGCCTCTTCCTTTGGCCGTC 60 72 2 Chow and Hazama, 1998 AACTCGTCTGGCTTTTCGCC RP2 AGCGCCAAAATAGTGAAGCC 60 72 2 Chow ...

    Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 43–51 : Autor(es): Smith, P.J. and P.M. Gaffney

Páginas