Inicio Inicio

CCAMLR

Comisión para la Conservación de los Recursos Vivos Marinos Antárticos

  • Inicio
  • Contenido
  • Inicio de sesión

Formulario de búsqueda

  • Medidas de conservación
  • Acerca de la CCRVMA
  • Ciencia
  • Circulares
  • Datos
  • Ejecución
  • Publicaciones
  • Reuniones
  • Pesquerías
  • English
  • Français
  • Русский
  • Español
  • Inicio
  • Page not found
Print this page
Increase font size
Decrease font size

Page not found

Mensaje de error

The page you requested does not exist. For your convenience, a search was performed using the query system files CCAMLR VME Registry 09022022 3 xlsx.
Advanced Search

Resultados de la búsqueda

  1. Evaluation of the results of trawl selectivity experiments by Poland, Spain and USSR in 1978/79, 1981/82 and 1986/87

    commercial fishery in Statistical Area 48. File:  13-Slosarczyk-et-al.pdf ... codends on Antarctic fish were evaluated in the light of additional information presented to the CCAMLR ... Committee of CCAMLR (8alguerias, 1988; Efanov et al., 1989; Zaucha, 1986 and 1988). 2. COMMENTS ON ... properly evaluated on the basis of available data. Polish hauls of 2 to 3 hours resulted in some cases in ... (Figure 3; see also Table 1.1 of the Appendix). Similarly, no clear relationship was observed between SF ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/6 (Selected Scientific Papers, SC-CAMLR-SSP/6) : 163–196 : Autor(es): Slosarczyk, W., E. Balguerias, K. Shust and S. Iglesias

  2. Analysis of krill trawling positions north of the South Shetland Islands (Antarctic Peninsula area), 1980/81–1999/2000

    effect. File:  02kawaguchi-segawa.pdf ... ecosystem. CCAMLR Science, 3: 13-30. Ichii, T. 2000. Krill harvesting. In: Everson, I. (Ed.). Krill ... CCAMLR Scie~~ce, Vol. 8 (2001): 25-36 ANALYSIS OF ... , TO MecTa TpaneHm B OCHOBHOM 3 a ~ ~ c e n ~ OT pacnpegeneHMx 6onee KpynHoro, nonoeospenoro KpHJIR ... sene~oro K ~ M I I X ) , Tatime o ~ a 3 b r ~ a n ~ ~ o s p a c ~ a l o ~ e e BnMxHHe Ha MecTa ...

    Science Journal Paper : CCAMLR Science, Volume 8 (CCAMLR Science, Volume 8) : 25–36 : Autor(es): Kawaguchi, S. and K. Segawa

  3. Age determination of Champsocephalus gunnari Lönnberg, 1905 (Channichthyidae) taken in the South Georgia area in 1990

    /86 year classes. The first small peak corresponds with the strong 1988 year class. File:  17 ... to analogous UK data from the Hill Cove cruise. 286 3. DISCUSSION An analysis of age/length ... gunnari from a range of age classes. CCAMLR/86/FA/12. Hobart, Australia. p. 12. KOCK, K.-H. 1981 ... and biology of Chaenichthyids from South Georgia. Nytt Magaz. Zool., 3: 79-93. Oslo. PANNELLA, G ... rossii from South Georgia. SC-CAMLR-VI/BG/43: 1-43. Hobart, Australia: CCAMLR. . RADTKE, RL. and D.J ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/7 (Selected Scientific Papers, SC-CAMLR-SSP/7) : 285–293 : Autor(es): Kochkin, P.N.

  4. Letter from the Co-conveners

    WG-FSA (CCAMLR-XXXVII, paragraph 5.30). These include topics such as further development and ... ccamlr@ccamlr.org, Steve.Parker@niwa.co.nz and clara.peron@mnhn.fr by 30 April 2019. A revised draft ... 0900h Hobart time (Australian Eastern Standard Time) on 3 June 2019. We look forward to seeing you ...

    Document : Site Section: Meetings

  5. Fishery Report: Dissostichus eleginoides South Georgia (Subarea 48.3)

    distribution of catches (time series) ......................................... 3 2. Stocks and areas ... ......................................................................... 4 3. Parameters and available data .......................................................... 4 ... 100 tonnes respectively, with an overall catch limit for SGSR of 3 000 tonnes. The total declared ... >1 fish per tonne with a total of 2 968 fish tagged (with 737 recaptures). 3. Most catch has been ...

    Document : Site Section: Publications

  6. Sources of variance in studies of krill population genetics

    regions therefore can not be adequately assessed unless multiple samples are taken from each region. File ... 07 jarman-nicol PROOF for pdf.indd CCAMLR Science ... . Keywords: krill, DNA, sample, genetics, population, CCAMLR 109 Sources of variance in studies of krill ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ...

    Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Autor(es): Jarman, S.N. and S. Nicol

  7. Characteristics of seasonal variation in diurnal vertical migration and aggregation of Antarctic krill (Euphausia superba) in the Scotia Sea, using Japanese fishery data

    visual predators. File:  09taki-etal.pdf ... 09 taki et al proof.indd CCAMLR Science, Vol. 12 ... shery data, Scotia Sea, trawling depth, vertical distribution, CCAMLR 165 Vertical migration and ... ; level 3 – dark green. The feeding index for each tow was calcu lated as (occurrence of frequency (%) of ... level 3) × 5 / 6. Results Vertical distribution of trawling depth The average trawling depth in SS ...

    Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 163–172 : Autor(es): Taki, K., T. Hayashi and M. Naganobu

  8. Fishery Report: Champsocephalus gunnari South Georgia (Subarea 48.3)

    ......................................................................... 2 3. Parameter estimation ................................................................... 3 ... 3.1 Estimation methods ................................................................ 3 ... Acoustic surveys ................................................................... 3 Trawl surveys ... ....................................................................... 3 Standing stock ...................................................................... 3 ...

    Document : Site Section: Publications

  9. An index of per capita recruitment

    Islands from 1979 to 1998 is presented. File:  11hewitt.pdf ... Short Notes CCAMLR Science, Vol. 7 (2000): 179-196 ... ) echantillonne a proximite des iles Shetland du Sud de 1979 a 1998. B cTaTbe npennomeH cnenymq~i? n o ~ a 3 a ... HJIM II0 rOnaM; (ii) HepeCTHTCR 100% ~ - J I ~ T H M x oco6efi; (iii) clMeeTcx p e n p e 3 e ~ ~ a ... , nOrHOpMaJIbHOe H PaBHOMepHOe paCIIpeneneHHR ~ e p o s r ~ ~ o c ~ e t i R1 H 3 ~ H ~ Y ~ H H R M. P a c n p e ...

    Science Journal Paper : CCAMLR Science, Volume 7 (CCAMLR Science, Volume 7) : 179–196 : Autor(es): Hewitt, R

  10. The utilization of seabird censuses for krill monitoring

    databases, calling for international cooperation on the subject. File:  16-Marschoff-et-al.pdf ... necessary complement to the land-based monitoring programs being developed by CCAMLR members and can ... purpose of krill abundance monitoring. Bearing in mind the concept of the CCAMLR Working Group on ... consequence of the selection of orthogonal functions as components of vector a'. 11; 3. As _! [fi(t)-fj(t ... was highly abundant 2) Sightings where krill was abundant 3) Sightings where krill was scarce or ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/4 (Selected Scientific Papers, SC-CAMLR-SSP/4) : 393-425 : Autor(es): Marschoff, E.R., J.G. Visbeek and L.R. Fontana

Páginas

  • « primero
  • ‹ anterior
  • …
  • 821
  • 822
  • 823
  • 824
  • 825
  • 826
  • 827
  • 828
  • 829
  • …
  • siguiente ›
  • última »

Datos de contacto

Correo electrónico: ccamlr [at] ccamlr [dot] org
Teléfono: +61 3 6210 1111
Facsímil: +61 3 6224 8744
Dirección: 181 Macquarie Street, Hobart, 7000, Tasmania, Australia

 

Enlaces destacados

  • Ofertas de empleo
  • Barcos con licencia para pescar
  • Lista de medidas de conservación vigentes en la temporada 2024/25
  • Logros de la CCRVMA

Recent and Upcoming Meetings

  • WG-ASAM-2025
  • WG-EMM-2025
  • WG-FSA-2025
  • SCIC-2025
  • SC-CAMLR-44

Footer Links Spanish

  • Inicio de sesión
  • Correo electrónico
  • Grupos de discusión de la CCRVMA
  • Grupos-e de la CCRVMA
  • Asistencia técnica
  • Derechos de autor
  • Descargo de responsabilidad y política de confidencialidad
  • Mapa del sitio
© Copyright - the Commission for the Conservation of Antarctic Marine Living Resources 2025, Todos los derechos están reservado..  |  Volver arriba  |  Sitio creado por Eighty Options