Inicio Inicio

CCAMLR

Comisión para la Conservación de los Recursos Vivos Marinos Antárticos

  • Inicio
  • Contenido
  • Inicio de sesión

Formulario de búsqueda

  • Medidas de conservación
  • Acerca de la CCRVMA
  • Ciencia
  • Circulares
  • Datos
  • Ejecución
  • Publicaciones
  • Reuniones
  • Pesquerías
  • English
  • Français
  • Русский
  • Español
  • Inicio
  • Page not found
Print this page
Increase font size
Decrease font size

Page not found

Mensaje de error

The page you requested does not exist. For your convenience, a search was performed using the query system files CCAMLR VME Registry 07122022v3 3 xlsx.
Advanced Search

Resultados de la búsqueda

  1. Letter from the Co-conveners

    WG-FSA (CCAMLR-XXXVII, paragraph 5.30). These include topics such as further development and ... ccamlr@ccamlr.org, Steve.Parker@niwa.co.nz and clara.peron@mnhn.fr by 30 April 2019. A revised draft ... 0900h Hobart time (Australian Eastern Standard Time) on 3 June 2019. We look forward to seeing you ...

    Document : Site Section: Meetings

  2. Fishery Report: Dissostichus eleginoides South Georgia (Subarea 48.3)

    distribution of catches (time series) ......................................... 3 2. Stocks and areas ... ......................................................................... 4 3. Parameters and available data .......................................................... 4 ... 100 tonnes respectively, with an overall catch limit for SGSR of 3 000 tonnes. The total declared ... >1 fish per tonne with a total of 2 968 fish tagged (with 737 recaptures). 3. Most catch has been ...

    Document : Site Section: Publications

  3. Sources of variance in studies of krill population genetics

    regions therefore can not be adequately assessed unless multiple samples are taken from each region. File ... 07 jarman-nicol PROOF for pdf.indd CCAMLR Science ... . Keywords: krill, DNA, sample, genetics, population, CCAMLR 109 Sources of variance in studies of krill ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ...

    Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Autor(es): Jarman, S.N. and S. Nicol

  4. Characteristics of seasonal variation in diurnal vertical migration and aggregation of Antarctic krill (Euphausia superba) in the Scotia Sea, using Japanese fishery data

    visual predators. File:  09taki-etal.pdf ... 09 taki et al proof.indd CCAMLR Science, Vol. 12 ... shery data, Scotia Sea, trawling depth, vertical distribution, CCAMLR 165 Vertical migration and ... ; level 3 – dark green. The feeding index for each tow was calcu lated as (occurrence of frequency (%) of ... level 3) × 5 / 6. Results Vertical distribution of trawling depth The average trawling depth in SS ...

    Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 163–172 : Autor(es): Taki, K., T. Hayashi and M. Naganobu

  5. Fishery Report: Champsocephalus gunnari South Georgia (Subarea 48.3)

    ......................................................................... 2 3. Parameter estimation ................................................................... 3 ... 3.1 Estimation methods ................................................................ 3 ... Acoustic surveys ................................................................... 3 Trawl surveys ... ....................................................................... 3 Standing stock ...................................................................... 3 ...

    Document : Site Section: Publications

  6. An index of per capita recruitment

    Islands from 1979 to 1998 is presented. File:  11hewitt.pdf ... Short Notes CCAMLR Science, Vol. 7 (2000): 179-196 ... ) echantillonne a proximite des iles Shetland du Sud de 1979 a 1998. B cTaTbe npennomeH cnenymq~i? n o ~ a 3 a ... HJIM II0 rOnaM; (ii) HepeCTHTCR 100% ~ - J I ~ T H M x oco6efi; (iii) clMeeTcx p e n p e 3 e ~ ~ a ... , nOrHOpMaJIbHOe H PaBHOMepHOe paCIIpeneneHHR ~ e p o s r ~ ~ o c ~ e t i R1 H 3 ~ H ~ Y ~ H H R M. P a c n p e ...

    Science Journal Paper : CCAMLR Science, Volume 7 (CCAMLR Science, Volume 7) : 179–196 : Autor(es): Hewitt, R

  7. The utilization of seabird censuses for krill monitoring

    databases, calling for international cooperation on the subject. File:  16-Marschoff-et-al.pdf ... necessary complement to the land-based monitoring programs being developed by CCAMLR members and can ... purpose of krill abundance monitoring. Bearing in mind the concept of the CCAMLR Working Group on ... consequence of the selection of orthogonal functions as components of vector a'. 11; 3. As _! [fi(t)-fj(t ... was highly abundant 2) Sightings where krill was abundant 3) Sightings where krill was scarce or ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/4 (Selected Scientific Papers, SC-CAMLR-SSP/4) : 393-425 : Autor(es): Marschoff, E.R., J.G. Visbeek and L.R. Fontana

  8. Validation of sink rates of longlines measured using two different methods

    archival nature of the data collected. File:  12wienecke-robertson.pdf ... wienecke-robertson proof.indd CCAMLR Science, Vol ... recently required by CCAMLR to achieve longline sink rates of 0.3 m.s–1 to a depth of 15 m (Conservation ... Measure 24-02, see CCAMLR, 2002). In principle, there are two methods of measuring sink rates: time ... , evaluation of methods, CCAMLR 181 Validation of longline sink rates of advantages that bottles have over ...

    Science Journal Paper : CCAMLR Science, Volume 11 (CCAMLR Science, Volume 11) : 179–187 : Autor(es): Wienecke, B. and G. Robertson

  9. By-catch of fish in the krill fishery

    areas of the South Georgia shelf. The problem is thought to be least in open ocean krill fishing. File ... Museum, USSR Academy of Sciences, 199034 Leningrad, USSR 3 VN1RO, 17a V. Krasnoselskaya, 107140 Moscow ... estimated total number or weight for the haul. 3. RESULTS Information on individual net hauls from both ... cruises is set out in Tables 3 to 4 for Subareas 48.3, 48.2 and 48.6 respectively. Estimated numbers of ... fishing in the southwest Atlantic. Antarctic Science, Vol. 3. FROLKINA, ZH.A. 1989. Methods of age ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/8 (Selected Scientific Papers, SC-CAMLR-SSP/8) : 381–401 : Autor(es): Everson, I., A. Neyelov and Y.B. Permitin

  10. Some comments on the procedure for testing estimators of krill abundance which utilise survey data

    suggestions are made in this regard. File:  11-Butterworth-et-al.pdf ... Ha MeTO,lle Kpatira), HanpaBJIeHHble Ha MO,lleJIHpOBaHHe nO,llo6Hb1X 333 ... exponential: (3) Though this is the same form as fitted by Miller and Hampton (1989a) to these data, the ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/8 (Selected Scientific Papers, SC-CAMLR-SSP/8) : 191–205 : Autor(es): Butterworth, D.S., D.L. Borchers and D.G.M. Miller

Páginas

  • « primero
  • ‹ anterior
  • …
  • 821
  • 822
  • 823
  • 824
  • 825
  • 826
  • 827
  • 828
  • 829
  • …
  • siguiente ›
  • última »

Datos de contacto

Correo electrónico: ccamlr [at] ccamlr [dot] org
Teléfono: +61 3 6210 1111
Facsímil: +61 3 6224 8744
Dirección: 181 Macquarie Street, Hobart, 7000, Tasmania, Australia

 

Enlaces destacados

  • Ofertas de empleo
  • Formularios de datos
  • Barcos con licencia para pescar
  • Lista de medidas de conservación vigentes en la temporada 2024/25

Recent and Upcoming Meetings

Footer Links Spanish

  • Inicio de sesión
  • Correo electrónico
  • Grupos de discusión de la CCRVMA
  • Grupos-e de la CCRVMA
  • Asistencia técnica
  • Derechos de autor
  • Descargo de responsabilidad y política de confidencialidad
  • Mapa del sitio
© Copyright - the Commission for the Conservation of Antarctic Marine Living Resources 2026, Todos los derechos están reservado..  |  Volver arriba  |  Sitio creado por Eighty Options