Resultados de la búsqueda

1. Catch per unit effort (CPUE) data from the early years of commercail krill fishing operations in the Atlantic sector of the Antarctic

   year class 1974/75, although the net was identical to the one in which, in accordance with mesh ... krill stock was dominated by age group l + (comprising more than 75%), and these small juveniles ... o 7- Non-outlier max o Non-outlier min 0 0 Median; 75% 25% _ 0 Outliers 1 Non-outlier max Non ... -outlier min 0 Median; 75% 25% - O Outliers 8 8 1 8 8 - Q Figure 1: CPUE data (kilogram/hour ...

   Science Journal Paper : CCAMLR Science, Volume 5 (CCAMLR Science, Volume 5) : 31–50 : Autor(es): Siegel, V., V. Sushin and U. Damm

2. Otolith and body size relationships in bigeye grenadier (Macrourus holotrachys) in CCAMLR Subarea 48.3

   Macquarie Islands. ANARE Research Notes, 75: 1–173. Xavier, J.C., J.P. Croxall and K. Reid. 2002 ... 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5 40 45 50 55 60 65 70 75 80 85 total length (cm) to ta l w ei ... 60 65 70 75 80 ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 133–143 : Autor(es): Morley, S. and M. Belchier

3. Krill (Euphausia superba) distribution in relation to water movement and phytoplankton distribution off the northern South Shetland Islands

   levels (0, 10, 20, 30, 40, 50, 75, 100, 125, 150 and 200 m). Chl-a concentration was determined by ... area D >130 g;,n2 100g/O1 2 50 75 10 25 5 0.5> Figure 5: Hydroacoustically detected laill ... .. ' .... :--~ 0 \0 ..... ····· O~ 0 54 (j ~ D»~'~' 347 g/m 2 100g/m2 75 50 25 10 5 0,5> o~ 178 g ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/8 (Selected Scientific Papers, SC-CAMLR-SSP/8) : 123–140 : Autor(es): Ichii, T., H. Ishii and M. Naganobu

4. Antarctic krill and ecosystem management – from Seattle to Siena

   Paper Title:  Antarctic krill and ecosystem management – from Seattle to Siena Abstract / Description:  This paper outlines CCAMLR’s development of a management approach for the Antarctic krill (Euphausia superba) fishery and associated ecosystem component between 1984 and 1995. The approach is

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 175–212 : Autor(es): Miller, D.G.M

5. Food and feeding of the mackerel icefish (Champsocephalus gunnari) around South Georgia in January/February 1991

   , Pseudopleuronectes americanus, with hypothesis regarding population homeostasis. J. Fish. Res. Bd. Can. 33: 63-75 ... 70 71 7 5 75/76 /6 76 77 78 79 81 85 85 91 A ,L A. A Figure 3: The frequency of occurrence of ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/8 (Selected Scientific Papers, SC-CAMLR-SSP/8) : 15–23 : Autor(es): Kock, K.-H., I. Everson, S. Campbell, G. Parkes, Z. Cielniaszek and J. Szlakowski

6. An assessment of the exploratory fishery for Dissostichus spp. on BANZARE Bank (CCAMLR Division 58.4.3b) based on fine-scale catch and effort data

   843 tonnes of D. maw- soni, 75 tonnes of D. eleginoides and 42 tonnes of by-catch species, comprising ... longlines failed to capture any D. mawsoni, compared with 485 long- lines (75% of total effort) that ... h (k g) 23 8 - - - - - - 23 8 C - 9 75 - 6 - - 90 R - 10 ... ) - - 1 75 5 8 59 7 - 21 54 8 07 8 20 5 84 McKinlay et al. 60 were around half ...

   Science Journal Paper : CCAMLR Science, Volume 15 (CCAMLR Science, Volume 15) : 55–78 : Autor(es): McKinlay, J.P., D.C. Welsford, A.J. Constable and G.B. Nowara

7. Seabird interactions with longlining operations for Dissostichus eleginoides at the South Sandwich Islands and South Georgia

   lines. The main line was subdivided into four sections by marker buoys. Each section consisted of 75 ... coils, each coil 75 m long with 30 to 38 hooks, giving a total length of main line of 22 500 m and a ... (4-5 kg) BRANCH JJJJJJJJJJ LINE (1.2 m) +STONE ANCHOR ( 2 0 Kg) P 75 COILS Figure 1 ...

   Science Journal Paper : CCAMLR Science, Volume 1 (CCAMLR Science, Volume 1) : 143–153 : Autor(es): Ashford, J.R., J.P. Croxall, P.S. Rubilar and C.A. Moreno

8. Analysis of krill trawling positions north of the South Shetland Islands (Antarctic Peninsula area), 1980/81–1999/2000

   indicate the 25-75 percentile range, vertical bars indicate the 10-90 percentile range. Open circles are ... indiqueiit I'intervalle de centile 25-75, les barres ~~ert ic~lles , celui de 10-90. Les cercles vides ... , Livingston y Rey Jorge/25 de Mayo. Los bloques muestran 10s percentiles de 25 a 75% y las barras verticales ...

   Science Journal Paper : CCAMLR Science, Volume 8 (CCAMLR Science, Volume 8) : 25–36 : Autor(es): Kawaguchi, S. and K. Segawa

9. Low genetic diversity in the Antarctic toothfish (Dissostichus mawsoni) observed with mitochondrial and intron DNA markers

   75°S (Gon and Heemstra, 1990). D. mawsoni appears to be restricted to waters managed solely by ... Gsyn TCCAACAGCGACATGTACCT 50 75 2 Chow, unpubl. CTCCTGTTCCATTCCAAACC Dyst6a ... surface waters (0–100 m) over bottom depths of 400–2 000 m; while larger immature fi sh (15–75 cm long ...

   Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 43–51 : Autor(es): Smith, P.J. and P.M. Gaffney

10. Selectivity of standard Polish commercial trawl codends on Antarctic fishing grounds

    in 75% (L7s) and the class retained in 25% (L2s), selectivity coefficient "Fs": ratio of the length ... ...... [,. ]0"'" 1 IN CODENO I I 100 "1 I I i I I 801 '75 I GO 1 50 ~o ~ I ! I • )' I ... CODEN 0 i 100 80 75 50 50 40 .,. 25 4'< /1- /?- /~ /" ;.--"" ,/1- o ~_X--x-~ JI ... CODEND wo 80 60 [ 40~ '75 50 25 ~~ -:;::::::- - --~~ - , I ro1 /: /: I I 1: , . 1 ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II (Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II) : 107-142 : Autor(es): Zaucha, J.

Páginas