Результаты поиска

1. Sources of variance in studies of krill population genetics

   tD N A h ap lo ty pe s 70 , 6 8, 6 3, 4 8 D if fe re nt ia ti on M eg an yc ti ph ... , 1 44 , 1 44 , 9 3, 9 6, 1 44 , 9 6, 1 82 N o d if fe re nt ia ti on B uc kl in ... e t a l., 1 99 7 75 m tD N A h ap lo ty pe s* 14 , 1 2, 1 4, 1 3, 1 6, 1 8 ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Автор(ы): Jarman, S.N. and S. Nicol

2. Fishery Report: Exploratory fishery for Dissostichus spp. in Subareas 88.1 and 88.2

   6 0° S TOT 88.1, 88.2 2 3. In 2010/11, the exploratory fishery for Dissostichus spp. in ... ) D. mawsoni D. eleginoides Total Korea, Republic of 6 3 77 77 New Zealand 4 3 244 244 Russia 3 ... 296 297 0 297 1999/00 - 3 2090 0 751 751 0 751 2000/01 6 10 2064 34 626 660 0 660 2001/02 10 3 2508 ... Hong Jin No. 707 17 (0) 40 (0) Jung Woo No. 3 6 (0) 35 (0) New Zealand Antarctic Chieftain ...

   Document : Site Section: Publications

3. Fishery Report: Dissostichus eleginoides South Georgia (Subarea 48.3)

   summarised in Table 3 (taken from SC-CAMLR-XXVII, Annex 6, Table 3). No new estimates of potential seabird ... and SC-CAMLR-XXVI, Annex 6, Part II, Table 20. 5 TOP 48.3 Table 3: Seabird observed mortality ... ......................................................................... 3 3. Parameters and available data.......................................................... 3 ... ............................................................... 5 6. By-catch of birds and mammals ....................................................... 5 ...

   Document : Site Section: Publications

4. Report on Bottom Fisheries and Vulnerable Marine Ecosystems

   2 6 5 4 2 3 4 2 2 30 Notifications (vessel*fishery) 2 6 25 12 7 3 4 4 2 65 Assessment submitted ... ............................................................ 2 DETAILS OF VULNERABLE MARINE ECOSYSTEMS ............................... 3 Register of VMEs ... .......................................................................... 3 VMEs present on the register and their status ........................................ 3 ... Measures to conserve registered VMEs ............................................... 3 Risk Areas ...

   Document : Site Section: Publications

5. Fishery Report: Dissostichus eleginoides Kerguelen Islands (Division 58.5.1)

   1 237 5 967 1999/00 3 046 3 093 6 139 2 600 8 739 2000/01 2 593 2 153 4 747 4 550 9 297 2001 ... /02 3 976 178 4 154 6 300 10 454 2002/03 5 291 0 5 291 5 518 10 809 2003/04 5 171 0 5 171 536 5 ... and areas ......................................................................... 3 3. Parameter ... .............................................................. 6 4. Stock assessment ........................................................................ 6 ...

   Document : Site Section: Publications

6. Fishery Report: Dissostichus eleginoides (TOP) Prince Edward Islands South African EEZ (Subareas 58.6 AND 58.7)

   distribution of catches (time series) ......................................... 3 2. Stocks and areas ... ......................................................................... 3 3. Parameter estimation ................................................................... 3 ... ............................................................... 5 6. Incidental mortality of birds and mammals ........................................... 5 ... Identification of levels of risk ..................................................... 6 6.3 Pot fishery by ...

   Document : Site Section: Publications

7. A first attempt at an assessment of the Patagonian toothfish (Dissostichus eleginoides) resource in the Prince Edward Islands EEZ

   6 C ha ng ed s te ep ne ss h = 0 .3 5 15 1 53 (1 4 00 2; 2 8 38 2) 18 ... (1 4 00 2; 2 8 38 2) 18 7 58 -4 .1 05 79 2 0. 30 2 0. 01 0 0. 11 6 0. 31 3 0 ... ) 32 6 09 -5 .9 48 91 9 0. 39 2 0. 04 3 0. 13 2 0. 23 5 0. 33 9 D ou bl e IU U c at ... ch 41 6 42 (3 8 03 6; 4 9 43 1) 51 5 52 -1 .8 61 1 45 4 0. 39 2 0. 00 1 ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 11–32 : Автор(ы): Brandão, A., D.S. Butterworth, B.P. Watkins and D.G.M. Miller

8. A generalised model for evaluating yield and the long-term status of fish stocks under conditions of uncertainty

   fishing effort 4 6 Age (years) Figure 3: Components of the fishing mortality coefficient,f, for krill ... Coefficient of M Coefficient of F 2 4 6 Age (years) 4 3 2 1 0 0 2 4 6 8 Age (years ... CCAMLR Science, Vol. 3 (1996): 31-54 A GENERALISED ... X 3 a n a c o ~ , n p e n ~ a 3 ~ a u e ~ ~ a ~ ,qnx pacveTa TaKoro p a 3 ~ e p a RonrocpovHoro ...

   Science Journal Paper : CCAMLR Science, Volume 3 (CCAMLR Science, Volume 3) : 31–54 : Автор(ы): Constable, A. and W.K. de la Mare

9. Fishery Report: Exploratory fishery for Dissostichus spp. in Subareas 88.1 and 88.2

   CCAMLR-XXVIII/BG/6). Table 3: Catches and catch limits for Dissostichus spp. and by-catch species ... 1 41 42 0 42 1998/99 2 2 2281 1 296 297 0 297 1999/00 - 3 2090 0 751 751 0 751 2000/01 6 10 2064 ... (6) 283 (1) 184 (0) 179 (0) 166 (0) San Aotea II 500 (12) 512 (2) 385 (10) 196 (3) 186 (0 ... 2001 127 1 1 0 0 0 1 0 1 4 2002 684 - 9 3 5 7 13 5 4 46 2003 808 - - 7 6 2 9 2 2 28 2004 1 811 ...

   Document : Site Section: Publications

10. Results of fish stock assessment survey, South Georgia, December 1987 - January 1988

    16% of the catch of this species. Most of the catch was from stratum 2 (3/6/1 *) (Table 1). The ... (range 0-80). (a) 9 8 P 7 e 6 5 c 4 e n 3 t 2 1 0 0 ( b) 1 8 1 6 P 14 e 1 2 ... 1 0 c 8 e n 6 t 4 2 0 ( c) 6 P 5 e 4 r c 3 e n 2 t 1 0 0 0 ... squamifrons. Contour interval is 1 kg (range 0-6). (a) ( b ) (c) 9 8 P 7 e 6 r 5 c 4 e n 3 ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II (Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II) : 19-52 : Автор(ы): McKenna, Jr., J.E. and S.B. Saila

Страницы