Результаты поиска
-
Fishery Report 2017: Dissostichus eleginoides Crozet Island French EEZ (Subarea 58.6)
0 5 10 2 4 4 3 4 32 2011 727 4 12 5 6 4 5 1 37 2012 693 1 24 20 8 6 2 61 2013 852 ... 2007 1 2008 32 2009 19 3 1 2010 27 2011 7 1 2012 17 2013 13 2014 6 ... 1999 48 - - - 500 548 - - 548 2000 - 193 6 199 220 419 - - 419 2001 - 812 3 815 100 915 - - 915 ... this method has been used in the fishery since then. 3. The fishery is open year-round, but most ...
Document : Site Section: Publications
-
Volume 9: CCAMLR. 1997. Statistical Bulletin, Vol. 9 (1987–1996). CCAMLR, Hobart, Australia.
Table 2 Table 3 Table 4 Table 5 Table 6 Table 7 Table 8 Table 9 Table 10 Table 11 Table 12 ... Tableau 3 Tableau 4 Tableau 5 Tableau 6 Tableau 7 Tableau 8 Tableau 9 Tableau 10 Tableau 11 ... Ta6JIH:u;a lA Ta6JIH:IJ;a 1.5 Ta6JIH:u;a 1. 6 PA3AEJIB Ta6JIH:IJ;a 2 Ta6JIH:u;a 3 Ta6.JIHI.J;a 4 ... : 61 3 6231 03"66 Facsimile: 61 3 62349965 E-mail: ccamlr@ccamlr.org Copies of this document are ...
Document : Site Section: Publications
-
Can toothfish catches be used to predict the presence of vulnerable benthic invertebrate taxa?
. 04 3 0. 00 2 60 P 0. 86 6 0. 08 9 0. 92 9 0. 02 6 0. 81 6 0. 13 9 0. 89 3 ... 0. 06 2 0. 91 2 0. 04 3 0. 86 9 0. 08 6 12 72 A ... 7 0. 73 4 0. 26 6 0. 87 5 0. 12 5 0. 68 8 0. 31 3 64 2 0. 93 8 0. 06 2 0 ... 41 7 3 0. 87 6 0. 12 4 0. 97 3 0. 02 7 0. 78 1 0. 21 9 0. 97 6 0. 02 4 0. 96 ...
Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 87–96 : Автор(ы): Parker, S.J. and M.H. Smith
-
Fishery Report: Exploratory fishery for Dissostichus spp. in Division 58.4.3a
. eleginoides D. mawsoni Total 2003/04 6 0 250 0 0 0 - 0 2004/05 3 4 250 97 9 105 98 203 2005/06 4 1 250 ... has been recorded, if they are still suitable for release (i.e. still in condition 3 or 4). 6 ... ......................................................................... 3 3. Parameter estimation ................................................................... 3 ... 3.1 Observations........................................................................ 3 3.2 ...
Document : Site Section: Publications
-
Use of the Leslie stock depletion model for the assessment of local abundance of Patagonian toothfish (Dissostichus eleginoides)
, 14, 15, 16, 17, 18, 20, 22 3, 9, 15, 19, 22 6, 10, 14 2, 8, 9, 12 Number of Data Series with ... a Negative Slope 12 15 6 8 2 6 2 3 Number of Data Series with a Significant Ne ative ... . Series 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 2 1 22 Table 6 ... -06 2.1E-06 -2.8E-06 2.5E-06 Series 1 2 3 4 5 6 7 8 9 10 11 12 1 3 14 15 16 ...
Science Journal Paper : CCAMLR Science, Volume 3 (CCAMLR Science, Volume 3) : 55–77 : Автор(ы): Parkes, G., C.A. Moreno, G. Pilling and Z. Young
-
Fishery Report: Dissostichus eleginoides South Sandwich Islands (Subarea 48.4)
mortality in Subarea 48.4 (from SC-CAMLR-XXVII, Annex 6, Table 3). Season Mortality rate (birds per ... (SC-CAMLR-XXVII, Annex 6, paragraph 9.10). 6 TOP 48.4 Figure 3: Positions of the ... IUU catch ........................................................................... 3 1.3 Size ... distribution of catches ........................................................ 3 2. Stocks and areas ...
Document : Site Section: Publications
-
By-catch of fishes captured by the krill fishing vessel Chiyo Maru No. 2 in Statistical Area 58 (January to March 1995)
T O Z U ~ ~ ~ p a 6 o ~ e AaeTCR K P ~ T K I ? ~ ~ IIOBTOPH~I& a ~ a n u 3 C O ~ ~ ~ H H ~ I X ... Haul 6 17 3 1 43 59 62 70 75 83 86 9 1 98 101 107 118 132 137 146 148 152 156 ... : Tabla 2: Tabla 3: Figura 1: Figura 2: Figura 3: Figura 4: Figura 5: Figura 6 ... CCAMLR Science, Vol. 3 (1996): 111-123 BY-CATCH OF ...
Science Journal Paper : CCAMLR Science, Volume 3 (CCAMLR Science, Volume 3) : 111–123 : Автор(ы): Watters, G
-
Sources of variance in studies of krill population genetics
tD N A h ap lo ty pe s 70 , 6 8, 6 3, 4 8 D if fe re nt ia ti on M eg an yc ti ph ... , 1 44 , 1 44 , 9 3, 9 6, 1 44 , 9 6, 1 82 N o d if fe re nt ia ti on B uc kl in ... e t a l., 1 99 7 75 m tD N A h ap lo ty pe s* 14 , 1 2, 1 4, 1 3, 1 6, 1 8 ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ...
Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Автор(ы): Jarman, S.N. and S. Nicol
-
Fishery Report: Exploratory fishery for Dissostichus spp. in Subareas 88.1 and 88.2
6 0° S TOT 88.1, 88.2 2 3. In 2010/11, the exploratory fishery for Dissostichus spp. in ... ) D. mawsoni D. eleginoides Total Korea, Republic of 6 3 77 77 New Zealand 4 3 244 244 Russia 3 ... 296 297 0 297 1999/00 - 3 2090 0 751 751 0 751 2000/01 6 10 2064 34 626 660 0 660 2001/02 10 3 2508 ... Hong Jin No. 707 17 (0) 40 (0) Jung Woo No. 3 6 (0) 35 (0) New Zealand Antarctic Chieftain ...
Document : Site Section: Publications
-
Fishery Report: Dissostichus eleginoides South Georgia (Subarea 48.3)
summarised in Table 3 (taken from SC-CAMLR-XXVII, Annex 6, Table 3). No new estimates of potential seabird ... and SC-CAMLR-XXVI, Annex 6, Part II, Table 20. 5 TOP 48.3 Table 3: Seabird observed mortality ... ......................................................................... 3 3. Parameters and available data.......................................................... 3 ... ............................................................... 5 6. By-catch of birds and mammals ....................................................... 5 ...
Document : Site Section: Publications
Страницы
- « первая
- ‹ предыдущая
- …
- 278
- 279
- 280
- 281
- 282
- 283
- 284
- 285
- 286
- …
- следующая ›
- последняя »