Результаты поиска
-
Low genetic diversity in the Antarctic toothfish (Dissostichus mawsoni) observed with mitochondrial and intron DNA markers
performed in 20 μl volumes for a minimum of 4 h, following the manufacturer’s recommendations (New England ... CCGCTTAGYGCTTTGAAGGC ND3/4 AGTATAAGTGACTTCCAATCAC 50 72 2 Cronin et al., 1993 TTAGAATCACAATCTAATGTTTT COI ... AGTATAAGCGTCTGGGTAGTC 60 72 2 Palumbi et al., 1991 CCAGAGATTAGAGGGAATCAGTG COII AAAGGGAGGAATTGAACCC 50 72 2 ... TGGCCTCTTCCTTTGGCCGTC 60 72 2 Chow and Hazama, 1998 AACTCGTCTGGCTTTTCGCC RP2 AGCGCCAAAATAGTGAAGCC 60 72 2 Chow ...
Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 43–51 : Автор(ы): Smith, P.J. and P.M. Gaffney
-
Fishery Report 2018: Dissostichus eleginoides and D. mawsoni South Sandwich Islands (Subarea 48.4)
experiment was initiated. 4. In 2008, the Commission agreed to divide Subarea 48.4 into a northern area ... 56 114 2011 70 39 15 54 2012 81 55 22 78 2013 115 72 40 112 2014 44, 24* 44 24 68 2015 42, 28 ... time series to 105–140 cm in 2013–2016 (Figure 1b). A second mode of smaller fish (60–80 cm) becomes ... ). (a) (b) 4 Tagging 15. In 2005, the UK conducted a pilot tagging program using a ...
Document : Site Section: Publications
-
The Soviet krill fishery in the Atlantic Sector of the Antarctic from 1977 to 1991: fishing effort distribution and interannual patterns
00 6 3 63 4 19 90 37 4 85 6 35 0 21 3 27 3 40 9 27 2 75 1 4 20 9 19 91 ... 7 61 15 3 20 6 0 22 80 36 17 4 21 4 88 0 70 35 1 14 6 2. 3 B ... 79 38 6 25 6 32 1 34 4 34 9 82 5 32 1 19 6 4 51 6 19 80 47 7 18 6 35 6 ... 97 8 44 0 51 6 35 6 75 2 3 89 9 19 81 44 8 13 2 28 8 86 8 42 0 43 4 28 ...
Science Journal Paper : CCAMLR Science, Volume 10 (CCAMLR Science, Volume 10) : 1–13 : Автор(ы): Litvinov, F.F., V.A. Sushin, G.A. Chernega and O.A. Berezhinsky
-
e-sc-xiii-a5-appD.pdf
... and hydrographic data are given in Table 4. 20. In order to calculate krill residence times, an ... 3a 185 61.3 1.4 3b 75 68.7 8.8 4 80 70.9 7.7 6.8 7.3 5 35 0 5.6 2.6 6 120 ... 12 14 16 -60 -60.5 -61 -61.5 -62 0 20 40 60 80 100 120 g/m^2 FRAM flow east (cm/sec ... of the data and analyses required were given in SC-CAMLR-XII, Annex 4, Appendix D. 3. The Agenda
application/pdf attached to:WS-FLUX-94Meeting Report : WS-FLUX-94
-
Results of fish larvae sampling by means of fine-meshed samplers attached to a bottom trawl
bottom trawl Abstract / Description: Fine-meshed samplers were attached to the top of a bottom trawl in ... , more vulnerable to damage. The nets were more effective in sampling when attached to the top of the ... 0 34 2 0 2 2 35 50 66 60 38 36 1768 1220 240 288 37 1 2 0 4 0 38 6 2 0 1 0 45 38 20 74 58 46 ... 0 1 2 340 790 0 1 6 190 290 4 2 50 640 4 6 50 760 4 8 20 60 na - data not available 75 ... : 134 p. 73 Table 1: Station 19 20 22 24 25 26 30 31 32 33 34 35 36 37 38 45 ... ). Abundance Index Total Volume of Samples 1 2 12+0.505 0.505 1 2 12+0.505 0.505 mm mm mm mm mm mm 0 4 20 ...
Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II (Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II) : 69-86 : Автор(ы): Ślósarczyk, W. and I. Wójcik
-
Analysis of albatross and petrel distribution within the CCAMLR Convention Area: results from the Global Procellariiform Tracking Database
for the estimation of distribution during the breeding season for all 20 albatross, petrel and ... -browed albatross from the Kerguelen Islands and South Georgia (Figure 4); light-mantled albatross from ... data correspond only to the closed period (Table 4), meaning that results from such an analy- sis ... Shelf by Argentine longline fishing vessels, 1999–2001. Bird Conservation International, 13 (4): 273 ...
Science Journal Paper : CCAMLR Science, Volume 13 (CCAMLR Science, Volume 13) : 143–174 : Автор(ы): BirdLife International (prepared by C. Small and F. Taylor)
-
Surface water masses, primary production, krill distribution and predator foraging in the vicinity of Elephant Island during the 1989-90 austral summer
north of their breeding colonies on Seal Island, but at different distances (18-100 km for fur seals, 20 ... -35 km for macaroni penguins, 11-24 km for chinstrap penguins) and at different depths (25m mean ... were characterized by distinct phytoplankton taxonomic groups. 4) There appears to be a generally ...
Meeting Document : WG-CEMP-90/11 : Автор(ы): A.F. Amos, J.L. Bengtson, O. Holm-Hansen, V.J. Loeb, M.C. Macaulay and J.H. Wormuth (USA)
-
SCIC-12
Vessel Monitoring System (VMS) Secretariat CCAMLR-XXXI/17 Rev. 4 Implementation of Conservation Measures ... Delegation of the European Union CCAMLR-XXXI/35 Information on illegal fishing in Statistical Area 58 ... in the Southern Ocean and beyond Submitted by ASOC CCAMLR-XXXI/BG/20 Heard Island and McDonald ...
Meeting
-
Effect of line sink rate on albatross mortality in the Patagonian toothfish longline fishery
. Sink rates to 4 m depth were greatest with 35 m (0.44 m/s) and 50 m (0.33 m/s) between weights. For ... -setting characteristics similar to the experimental vessel, this sink rate should be achievable with 4 kg ... 4 M 6 ~ n a c a ~ o i i B~ICOKOE npti HHTepsanax 35 M (0.44 M/c~K.) H 50 M (0.33 M/c~K.). Anx ... 4 m de profundidad fueron mayores cuando 10s pesos se colocaron a intervalos de 35 m (0,44 m/s) y ... rates to 4 m depth ranged from 0.44-0.1 m/s with weights at 35 and 200 m intervals respectively ... added to the distances shown). With 35 m weight spacing at 4 m depth, the longline would be 38 m ...
Science Journal Paper : CCAMLR Science, Volume 7 (CCAMLR Science, Volume 7) : 133–150 : Автор(ы): Robertson, G.G
-
Fishery Report: Exploratory fishery for Dissostichus spp. (TOT) in Division 58.4.3b
502 2009 6 2 120 15 89 104 610 714 2010 4 1 0 (72)** 2 12 14 171 185 2011 1 1 0 (15)** 2 9 11 ... Maru No. 3 North 60°S 20 114 134 Namibia Antillas Reefer North 60°S 20 6 26 Uruguay Banzare North ... 157 20 2 2009 80 4 50 1 102 20 <1 2010 80 2 50 <1 22 20 <1 2011 - 1 - <1 - - <1 2012 - 1 - <1 ... estimation ................................................................... 4 3.1 Observations ...
Document : Site Section: Publications
Страницы
- « первая
- ‹ предыдущая
- …
- 156
- 157
- 158
- 159
- 160
- 161
- 162
- 163
- 164
- …
- следующая ›
- последняя »