Résultats de la recherche
-
Demographic characteristics of the Adélie penguin population on Béchervaise Island after 12 years of study
63 18 80 72 0 0. 38 19 99 / 00 37 31 18 36 99 0 0. 54 20 00 / 01 35 ... 17 36 34 0. 02 19 95 / 96 35 75 18 13 72 7 0. 40 19 96 / 97 38 42 ... gg ed (m in im um a ge 4 y ea rs ) 76 54 59 30 20 28 10 25 17 30 (a ) N um be rs ... % ) 7+ 35 (4 6% ) 29 (5 4% ) 35 (5 9% ) 18 (6 0% ) 15 (7 5% ) 22 (7 9 ...
Science Journal Paper : CCAMLR Science, Volume 10 (CCAMLR Science, Volume 10) : 53–74 : Auteur(s): Clarke, J., L.M. Emmerson, A. Townsend and K.R. Kerry
-
COLLAPSE OF SOUTH AFRICA’S PENGUINS IN THE EARLY 21ST CENTURY
from about 56 000 pairs in 2001 to some 21 000 pairs in 2009, a loss of 35 000 pairs (>60%) in eight ... 000 pairs in 2003. In the Western Cape, numbers decreased from a mean of 35 000 pairs in 2001–2005 to ...
Meeting Document : WG-EMM-11/P8 : Auteur(s): R.J.M. Crawford, R. Altwegg, B.J. Barham, P.J. Barham, J.M. Durant, B.M. Dyer, D. Geldenhuys, A.B. Makhado, L. Pichegru, P.G. Ryan, L.G. Underhill, L. Upfold, J. Visagie, L.J. Waller and P.A. Whittington
-
An impact assessment framework for bottom fishing methods in the CAMLR Convention Area
. 2 72 3. 0 24 0 00 17 .4 4 35 1 0. 40 0. 2 0. 08 0 T ot al s (i nc lu d ... °W 150 80° S 75° S 70° S 65° S 60° S 600-1800 200-600 60-200 20-60 7-20 2-7 NZ fishing effort ... fishing effort 600–1800 200–600 60–200 20–60 7–20 2–7 150 °E 160° E 170°E 180° 170°W 160°W 150°W ... kb on e 3 61 5. 2 1 3 61 5. 2 1 00 0 3. 62 4 35 1 0. 08 3 0. 05 0. 00 ...
Science Journal Paper : CCAMLR Science, Volume 16 (CCAMLR Science, Volume 16) : 195–210 : Auteur(s): Sharp, B.R., S.J. Parker and N. Smith
-
Fishery Report 2014: Exploratory fishery for Dissostichus spp. in Subareas 88.1 and 88.2
- - 0 2000 - 0 - 0 - - 0 2001 - 0 - 0 - - 0 2002 40 4 - 0 - 20 0 2003 60 18 - 0 - 140 8 2004 60 37 ... ) 20 (0) Hong Jin No. 707 17 (3) 40 (3) 38 (1) 22 (1) Jung Woo No. 3 6 (0) 35 (0 ... ) 158 (4) 332 (28) 38 (1) 183 (23) 220 (25) UK Argos Georgia 50 (0) 220 (35) 182 (4) 51 (2 ... 426 112 133 4 7 190 160 20 2009 430 183 135 7 7 088 160 16 2010 430 119 142 8 6 796 160 15 2011 430 ...
Document : Site Section: Publications
-
e-sc-xxv-a6.pdf
... -SAM-04/20) showed that icefish of all age classes spend time in midwater and reinforced the evidence ... length relationship with slope of 20 (i.e. TS = 20 log10(length) + B20). There were considerable ... 20 for the TS–length relationship may not be appropriate for icefish. Application of the new target ... more dispersed form. Most icefish caught during the survey ranged in length between 20 and 30 cm
application/pdf attached to:SG-ASAM-06Meeting Report : SG-ASAM-06
-
e-sc-xxvii-a5.pdf
... some vessels targeting krill in 2007/08. Scientific observers have participated in 60 cruises so far ... preliminary assessment of yield for the area of Division 58.5.2 to the west of 79°20'E using standard CCAMLR ... (60 kg/thousand hooks in 2008 versus 33 kg/thousand hooks in 2001) as that observed when the catch ... Sea assessment was able to achieve satisfactory matches for all but 10–20 tags, so discrepancy rates
application/pdf attached to:WG-FSA-08Meeting Report : WG-FSA-08
-
e-sc-v-a4.pdf
... (1969/70 at South Georgia, and 1971/72 at Kerguelen). It is also apparent from the more detailed data ... . 20. The trends in biomass, as estimated from VPA, are shown in Figure 5a. This shows large ... it is probably well below its initial abundance. Champsocephalus gunnari 35. Data are ... catches originated from King George Island and consisted of individuals of 35–47 cm. These were mostly
application/pdf attached to:WG-FSA-86Meeting Report : WG-FSA-86
-
Low genetic diversity in the Antarctic toothfish (Dissostichus mawsoni) observed with mitochondrial and intron DNA markers
AGTATAAGCGTCTGGGTAGTC 60 72 2 Palumbi et al., 1991 CCAGAGATTAGAGGGAATCAGTG COII AAAGGGAGGAATTGAACCC 50 72 2 ... TGGCCTCTTCCTTTGGCCGTC 60 72 2 Chow and Hazama, 1998 AACTCGTCTGGCTTTTCGCC RP2 AGCGCCAAAATAGTGAAGCC 60 72 2 Chow ... performed in 20 μl volumes for a minimum of 4 h, following the manufacturer’s recommendations (New England ... CCGCTTAGYGCTTTGAAGGC ND3/4 AGTATAAGTGACTTCCAATCAC 50 72 2 Cronin et al., 1993 TTAGAATCACAATCTAATGTTTT COI ...
Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 43–51 : Auteur(s): Smith, P.J. and P.M. Gaffney
-
Fishery Report 2018: Dissostichus eleginoides and D. mawsoni South Sandwich Islands (Subarea 48.4)
56 114 2011 70 39 15 54 2012 81 55 22 78 2013 115 72 40 112 2014 44, 24* 44 24 68 2015 42, 28 ... time series to 105–140 cm in 2013–2016 (Figure 1b). A second mode of smaller fish (60–80 cm) becomes ... fish of each species of Dissostichus is required to achieve a minimum tag-overlap statistic of 60 ... 48.4 (Figure 2). Life-history parameters 20. Dissostichus spp. are large long-lived species ...
Document : Site Section: Publications
-
The Soviet krill fishery in the Atlantic Sector of the Antarctic from 1977 to 1991: fishing effort distribution and interannual patterns
00 6 3 63 4 19 90 37 4 85 6 35 0 21 3 27 3 40 9 27 2 75 1 4 20 9 19 91 ... 7 61 15 3 20 6 0 22 80 36 17 4 21 4 88 0 70 35 1 14 6 2. 3 B ... 79 38 6 25 6 32 1 34 4 34 9 82 5 32 1 19 6 4 51 6 19 80 47 7 18 6 35 6 ... 97 8 44 0 51 6 35 6 75 2 3 89 9 19 81 44 8 13 2 28 8 86 8 42 0 43 4 28 ...
Science Journal Paper : CCAMLR Science, Volume 10 (CCAMLR Science, Volume 10) : 1–13 : Auteur(s): Litvinov, F.F., V.A. Sushin, G.A. Chernega and O.A. Berezhinsky