Search results
-
Fishery report: Dissostichus eleginoides Crozet Island inside the French EEZ (Subarea 58.6)
/98 787 1758 2545 1998/99 877 1845 2722 1999/00 1017 1430 2447 2000/01 1091 685 1776 2001/02 1158 ... 58.6 (fine-scale data) for the fishing seasons 1999/2000 to 2004/05 were examined. A total of 4 601 ... , after the above restrictions were applied, on which to base an estimate of the CPUE value for 1999 ... . 2 TOP 58.6 French EEZ 1999 2000 2001 2002 2003 2004 2005 Season 0.0 0.1 0.2 0.3 0.4 St an da ...
Document : Site Section: Publications
-
Fishery Report: Dissostichus eleginoides Heard Island (Division 58.5.2)
7915 1998/99 2 3690 0 0 3547 3547 427 3974 1999/00 2 3585 0 0 3566 3566 1154 4720 2000/01 2 2995 ... 383 62 12 1999 2 Apr SC DT 84 528 80 661 139 93 2000 6 May SC DT 39 839 32 952 103 9 2001 1 May SC ... vessel in April 1999. • Group 3 – the first survey in the region undertaken by the RV Aurora Australis ... Uniform 1 12 6, 4, 7.5, 4, 7.5 7.5, 7.5, 7.5, 4, 8, 8, 8, 8, 8, 8 Survey group q 3 1999 survey 1990 ...
Document : Site Section: Publications
-
Low genetic diversity in the Antarctic toothfish (Dissostichus mawsoni) observed with mitochondrial and intron DNA markers
edited in CHROMAS (Technely- sium, Australia), and aligned in the BIOEDIT pro gram (Hall, 1999). Tests ... 7 (Quattro and Jones, 1999) with six enzymes (Dpn II, Hha I, Hpa II, Hpy188 I, HpyCH4 IV and Rsa ... ., 1999). Table 1: Mitochondrial DNA and intron primers evaluated with Dissostichus mawsoni. PCR ... 1 Quattro and Jones, 1999 CAGTCGGTCRGCRTTGGAGATGTC Gsyn TCCAACAGCGACATGTACCT 50 75 2 Chow, unpubl ...
Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 43–51 : Author(s): Smith, P.J. and P.M. Gaffney
-
Seals: Trophic modelling of the Ross Sea
Sound have been studied for over 30 years (e.g. Stirling 1969; Burns et al. 1998, 1999; Testa & Siniff ... continent coastline (Burns et al. 1999). It is unclear to what extent Weddell seals are migratory between ... for a number of years (Burns et al. 1999). After a number of years, fewer than 25% of pups born in Erebus Bay ... to observe pups returning to their natal areas (Burns et al 1999). Here, we assume that Weddell seals ...
Document : Site Section: Publications
-
Fishery Report: Closed fishery for Dissostichus spp. in Divisions 58.4.4a and 58.4.4b
), the fishery was reclassified as exploratory in 1999. In 1999 the divisions were subdivided into SSRUs ... operated in the exploratory fishery for Dissostichus spp. in Divisions 58.4.4a and 58.4.4b in 1999/2000 ... 1298 1998/99 0 572 0 0 0 0 0 1519 1519 1999/00 2 370 84 0 72 0 156 1254 1410 2000/01 1 370 ... by total reported catch in Table 1(a)). Season D. eleginoides D. mawsoni A B C D A B C D 1999/00 84 ...
Document : Site Section: Publications
-
Explanation of terms
to environmental variability, both physical and biological. CEMP039;s major function is to monitor the key life ... in a sovereign State different from that of the ship039;s owners, and flying that State039;s civil ensign ... the regulations of the owner039;s country. The use of multiple flags of convenience is common practice for IUU ... location of fishing vessels operating in the Convention Area. The VMS is a key component of CCAMLR039 ...
Page : Site Section: The Organisation
-
Variations in condition indices of mackerel icefish at South Georgia from 1972 to 1997
: (i) direct estimates of krill density from acoustic surveys (Brierley et al., 1999); and (ii) indirect ... et al., (1999) was compared wit11 C, obtained from fish caught in the same month as the krill ... to local krill availability (Reid et al., 1999). These parameters are considered to be integrating over ... and I. Everson. 1999. Acoustic estimates of krill density at South Georgia, 1981 to 1998. CCAMLR Science. 6: 47 ...
Science Journal Paper : CCAMLR Science, Volume 8 (CCAMLR Science, Volume 8) : 119–132 : Author(s): Everson, I. and K.-H. Kock
-
Media
Media releases You can subscribe to our media contact list and we039;ll email new media releases ...
Page : Site Section: The Organisation
-
Fishery report: Dissostichus eleginoides Prince Edward Islands South African EEZ (Subareas 58.6 and 58.7)
5 827 1996/97 1 193 7 327 8 520 1997/98 637 598 1 235 1998/99 301 173 474 1999/00 1 015 191 1 206 ... /99 4 2 750 956 1 014 1 970 1999/00 3 2 250 1 562 1 210 2 772 2000/01 5 2 250 352 352 704 2001/02 ... 1997/98 1998/99 1999/00 2000/01 2001/02 2003/04 2004/05 2005/06 Le ng th (c m ) Weighted ... (0.228) 1999/00 0.618 0.854 (0.180) 2000/01 0.375 0.524 (0.113) 2001/02 0.390 0.597 (0.137) 2002/03 ...
Document : Site Section: Publications
-
The case for including the Ross Sea continental shelf and slope in a Southern Ocean network of marine protected areas
. According to an independent analysis of human impacts on the world039;s oceans, the Ross Sea is the least ...
Meeting Document : CCAMLR-XXIX/BG/26 : Author(s): ASOC Observer