Главная Главная

CCAMLR

Комиссия по сохранению морских живых ресурсов Антарктики

  • Главная
  • Перейти к контенту сайта
  • Вход
  • Моя учетная запись

Форма поиска

  • Об АНТКОМ
  • Меры по сохранению
  • Наука
  • Промыслы
  • Соблюдение
  • Данные
  • Совещания
  • Публикации
  • Циркуляры
  • English
  • Français
  • Русский
  • Español
  • Главная
  • Поиск
  • Результаты поиска
  • Site
  • 3到6岁动画片
  • Science Journal Paper
  • Site

Текущий поиск

Найдено 396 элементов

  • 3到6岁动画片
  • (-) Science Journal Paper

Filter by тип материала:

  • (-) Science Journal Paper
Print this page
Increase font size
Decrease font size

Site

Advanced Search

Результаты поиска

  1. Sources of variance in studies of krill population genetics

    tD N A h ap lo ty pe s 70 , 6 8, 6 3, 4 8 D if fe re nt ia ti on M eg an yc ti ph ... , 1 44 , 1 44 , 9 3, 9 6, 1 44 , 9 6, 1 82 N o d if fe re nt ia ti on B uc kl in ... e t a l., 1 99 7 75 m tD N A h ap lo ty pe s* 14 , 1 2, 1 4, 1 3, 1 6, 1 8 ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ...

    Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Автор(ы): Jarman, S.N. and S. Nicol

  2. A first attempt at an assessment of the Patagonian toothfish (Dissostichus eleginoides) resource in the Prince Edward Islands EEZ

    6 C ha ng ed s te ep ne ss h = 0 .3 5 15 1 53 (1 4 00 2; 2 8 38 2) 18 ... (1 4 00 2; 2 8 38 2) 18 7 58 -4 .1 05 79 2 0. 30 2 0. 01 0 0. 11 6 0. 31 3 0 ... ) 32 6 09 -5 .9 48 91 9 0. 39 2 0. 04 3 0. 13 2 0. 23 5 0. 33 9 D ou bl e IU U c at ... ch 41 6 42 (3 8 03 6; 4 9 43 1) 51 5 52 -1 .8 61 1 45 4 0. 39 2 0. 00 1 ...

    Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 11–32 : Автор(ы): Brandão, A., D.S. Butterworth, B.P. Watkins and D.G.M. Miller

  3. A generalised model for evaluating yield and the long-term status of fish stocks under conditions of uncertainty

    fishing effort 4 6 Age (years) Figure 3: Components of the fishing mortality coefficient,f, for krill ... Coefficient of M Coefficient of F 2 4 6 Age (years) 4 3 2 1 0 0 2 4 6 8 Age (years ... CCAMLR Science, Vol. 3 (1996): 31-54 A GENERALISED ... X 3 a n a c o ~ , n p e n ~ a 3 ~ a u e ~ ~ a ~ ,qnx pacveTa TaKoro p a 3 ~ e p a RonrocpovHoro ...

    Science Journal Paper : CCAMLR Science, Volume 3 (CCAMLR Science, Volume 3) : 31–54 : Автор(ы): Constable, A. and W.K. de la Mare

  4. Results of fish stock assessment survey, South Georgia, December 1987 - January 1988

    16% of the catch of this species. Most of the catch was from stratum 2 (3/6/1 *) (Table 1). The ... (range 0-80). (a) 9 8 P 7 e 6 5 c 4 e n 3 t 2 1 0 0 ( b) 1 8 1 6 P 14 e 1 2 ... 1 0 c 8 e n 6 t 4 2 0 ( c) 6 P 5 e 4 r c 3 e n 2 t 1 0 0 0 ... squamifrons. Contour interval is 1 kg (range 0-6). (a) ( b ) (c) 9 8 P 7 e 6 r 5 c 4 e n 3 ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II (Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II) : 19-52 : Автор(ы): McKenna, Jr., J.E. and S.B. Saila

  5. Age determination of Champsocephalus gunnari Lönnberg, 1905 (Channichthyidae) taken in the South Georgia area in 1990

    : Figure 3: Figure 4: Figure 5: Figure 6: Figure 7: Figure 8: Ta6JUlu;a 1: Ta6Jm:u;a 2: 292 ... : PHCYHOK 2: PHCYHOK 3: PHCYHOK 4: PHCYHOK 5: PHCYHOK 6: PHCYHOK 7: PHCYHOK 8: Tabla 1 ... to analogous UK data from the Hill Cove cruise. 286 3. DISCUSSION An analysis of age/length ... HX B03paCTa. Bonp. HXTHOJIOrHH, T. 20, BbIn. 6 (125): 941-944. K01.JKHH, n.H. 1985. AHaJIH3 ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/7 (Selected Scientific Papers, SC-CAMLR-SSP/7) : 285–293 : Автор(ы): Kochkin, P.N.

  6. The ecosystem approach to managing fisheries: achieving conservation objectives for predators of fished species

    : (i) K a K O e n 0 6 0 ~ ~ 0 e B O ~ A ~ ~ C T B M ~ I I p O M h I C e n OKaF3blBaeT Ha 3 K O C H ... C T e M Y , (ii) KaKHMH Q O n X H b I 6 b 1 ~ b n P C f P O A O O X p a H H b l e q e n l l ... nponyKuIrrf xlrLqHcteoe, c s s ~ x i ~ ~ o i i c n o ~ p e 6 n e ~ m e ~ npoMbIcnonbrx nrrnon 11 onric~inae ... , MorYT 6b1~1-r HenOCpenCTBeHHO CBR3BHb1 C l303flefic~B~eM ITpOMblCna. B HaCToRlUee BpeMR 3 T 0 He ...

    Science Journal Paper : CCAMLR Science, Volume 8 (CCAMLR Science, Volume 8) : 37–64 : Автор(ы): Constable, A.J

  7. On the instantaneous natural mortality rate of Champsocephalus gunnari, South Georgia (Subarea 48.3)

    -45 14 13 0 0 27 46-47 2 8 0 1 11 48-49 2 6 0 3 11 50-51 0 8 0 2 10 52-53 0 6 0 3 9 54-55 0 5 0 3 ... first half of 1972. Length Age group (cm) 1 2 3 4 5 6 7 8 9 10 16-17 15 0 0 0 0 0 0 0 0 0 18-19 ... 275 246 5 20 121 68 18 227 238 6 17 83 16 3 119 131 7 16 29 0 4 49 45 8 1 10 0 4 15 12 9 0 7 0 3 ... 4 - M=O.70 324 Tableau 1: Tableau 2: Tableau 3: Tableau 4: Tableau 5: Tableau 6 ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/7 (Selected Scientific Papers, SC-CAMLR-SSP/7) : 313–326 : Автор(ы): Frolkina, G.A. and R.S. Dorovskikh

  8. Notes on the use of virtual population analysis for stock assessment of the mackerel icefish, Champsocephalus gunnari (Lönnberg, 1906) in Subarea 48.3 for the 1990/91 and 1991/92 seasons

    values for 3, 4 and 5 year olds in 1991 and 4, 5 and 6 year olds in 1992 are 55 reasonably ... capture of fish by gillnets. Mater. Poznaniyu Russ. Rybolovstva, 3 (6): 56-99. (In Russian.) BASSON, M ... MAFFl and MAFF2 Year Effort 1 2 3 4 5 6+ 1987 100 17265 298562 181115 15760 1831 257 1988 100 18858 ... inverse variance weighting Final iteration, MAFF3 Year Effort 1 2 3 4 5 6+ 1987 100 20361 386123 ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 49–79 : Автор(ы): Parkes, G.

  9. Temporal variability and the interrelationships between CEMP parameters collected on Adélie penguins at Béchervaise Island

    8 -0 .7 2 -0 .5 5 -0 .6 0 -0 .3 0 0. 28 P v al ue 0. 30 0. 23 0. 37 ... n sh if t ( d ay s) 17 .3 6 16 .2 0 18 .4 0 0. 64 43 12 3. 71 Se co nd in ... 10 6. 90 ln m al e gu ar d fo ra gi ng tr ip (h ou rs ) 3. 25 7 3. 00 3 ... ) 3. 57 6 3. 04 4. 00 0. 26 62 10 7. 44 ln m al e cr èc he fo ra gi ng tr ...

    Science Journal Paper : CCAMLR Science, Volume 10 (CCAMLR Science, Volume 10) : 75–90 : Автор(ы): Emmerson, L.M., J. Clarke, K.R. Kerry and C. Southwell

  10. Comparison of age readings from scales and otoliths of the Patagonian toothfish (Dissostichus eleginoides) from South Georgia

    pocTa pb16, nonyqeHHbIe B p e 3 y n b ~ a ~ e npMMeHeHMrr 0 6 0 6 ~ 1 ~ e ~ ~ o r o ypaeHeHMn @OH E e ... AND METHODS Age 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 2 1 22 23 ... 981.05 3 579.58 4 104.30 4 565.27 5 120.28 5 655.08 6 002.62 6 325.08 6 707.18 7 069.12 7 ... Patagonian Toothfish from South Georgia Age 2 Age 3 ;: J Age 6 Scale radius (p) :: 1 Age l 0 ...

    Science Journal Paper : CCAMLR Science, Volume 5 (CCAMLR Science, Volume 5) : 191–203 : Автор(ы): Cassia, M.C

Страницы

  • « первая
  • ‹ предыдущая
  • …
  • 8
  • 9
  • 10
  • 11
  • 12
  • 13
  • 14
  • 15
  • 16
  • …
  • следующая ›
  • последняя »

Контакты

E-mail: ccamlr [at] ccamlr [dot] org
Телефон: +61 3 6210 1111
Факс: +61 3 6224 8744
Адрес: 181 Macquarie Street, Hobart, 7000, Tasmania, Australia

 

Быстрые ссылки

  • Вакансии
  • Лицензированные суда
  • Список действующих мер по сохранению 2024/25 г.
  • Достижения АНТКОМ

Current and Upcoming Meetings

  • WG-FSA-2025
  • SCIC-2025
  • SC-CAMLR-44
  • CCAMLR-44
  • SCAF-2025

Footer Links Russian

  • Вход
  • Веб-почта
  • Обсуждения АНТКОМ
  • э-группы АНТКОМ
  • Служба поддержки
  • Авторское право
  • Отказ от ответственности и конфиденциальность
  • Карта веб-сайта
© Copyright - the Commission for the Conservation of Antarctic Marine Living Resources 2025, Все права защищены.  |  Наверх  |  Сайт разработан компанией Eighty Options