Результаты поиска

1. Surface water circulation in krill fishing areas near the South Shetland Islands

   . Naganobu National Research Institute of Far Seas Fisheries 5-7-1, Orido, Shimizu, 424 Japan Abstract ... were re-calculated for each 5' latitude X 10' longitude block (5 X 5 n miles) for each month of the ... exhibited different patterns for these three regions (Figure l). Buoys 1 and 5 deployed in the oceanic ... northern shelf break. Buoys 1, 5 and 6 which travelled across the Scotia Sea to South Georgia and the ...

   Science Journal Paper : CCAMLR Science, Volume 3 (CCAMLR Science, Volume 3) : 125–136 : Автор(ы): Ichii, T. and M. Naganobu

2. Sources of variance in studies of krill population genetics

   reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ... an e t a l., 2 00 2 82 m tD N A h ap lo ty pe s 65 , 6 1, 5 9, 4 7 D if fe re ... nd M ac D on al d , 1 98 4 7 al lo zy m e lo ci 29 5, 1 01 , 2 32 , 9 3, 3 59 ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Автор(ы): Jarman, S.N. and S. Nicol

3. Characteristics of seasonal variation in diurnal vertical migration and aggregation of Antarctic krill (Euphausia superba) in the Scotia Sea, using Japanese fishery data

   , T. Hayashi and M. Naganobu National Research Institute of Far Seas Fisheries 5-7-1 Orido, Shimizu ... level 3) × 5 / 6. Results Vertical distribution of trawling depth The average trawling depth in SS ... January, but decreased after February and was at its lowest level (0.17) from April to August (Figure 5 ... M TW SR S M RN DA Y AF T SS T ET W DS K NI T 0 5 10 15 20 25 Jan. 0 20 40 60 NIT DWN ...

   Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 163–172 : Автор(ы): Taki, K., T. Hayashi and M. Naganobu

4. Can we use discriminant function analysis to sex penguins prior to calculating an index of a morphometric characteristic?

   size required in order to be 80% certain of detecting the difference at the 5% level of significance ... ba = k(1l + aa) substituting equation (3) bA = l+kaA substituting equation (4) (5) We can ... and J.L' are widely separated or r is very small. 264 5. THE EFFECT OF SEX RATIO ON COMBINED ... % certain of detecting the difference between true and apparent means at 5% significance level (replicates ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 259–272 : Автор(ы): Agnew, D.J.

5. Krill population biology during the 1991 Chilean Antarctic krill fishery

   area approximately 40 x 40 m), which was towed at a mean velocity of 2.65 knots for 5 to 95 minutes ... the largest modes between 46 and 47 mm TL (Figure 5). The analysis of the size frequency ... 7 6 % F 5 r 9 4 q u3 e n ~~~ o_~"~·~e:m.,es c 2 y 1 20 23 26 29 32 35 38 41 44 47 ... ~fffffffffffffffffffffffffTfiTfiTfl11/ 20 23 26 29 32 35 38 41 44 47 50 53 56 Total length (mm) Figure 5: Size frequency ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 223–235 : Автор(ы): Mujica R., A., E. Acuña S. and A. Rivera O.

6. Estimating the impact of depredation by killer whales and sperm whales on longline fishing for toothfish (Dissostichus eleginoides) around South Georgia

   (Figure 5). In order to estimate the impact of cetacean dep- redation on total extractions, the declared ... , because the proportion of sets where they are present is between 3 and 5%. Over the seven years of study ... 66 9 4 67 1 4 67 1 20 05 3. 4% 5. 1% 8. 1% 3 05 7 3 16 0 3 21 3 3 ... 30 3 20 06 4. 2% 4. 9% 4. 4% 3 53 5 3 68 3 3 70 7 3 69 0 20 07 3. 8 ...

   Science Journal Paper : CCAMLR Science, Volume 17 (CCAMLR Science, Volume 17) : 163–178 : Автор(ы): Moir Clark, J. and D.J. Agnew

7. Results of fish larvae sampling by means of fine-meshed samplers attached to a bottom trawl

   samples taken during the period 4 February-5 March 1986. In the bottom samples collected during this ... 320 0 612 40 280 2 514 1 0 180 0 128 1 0 560 5 2 1 0 170 0 32 4 320 6 2 na na 0 6 350 510 3 0 ... 0.505 mm mm X A B C 0 X A B C 0 19 0 0 20 0 612 21 * 5 22 2 514 23 0 0 24 0 128 25 5 2 26 0 ... 256 42 56 64 67 1 6 2 58 0 68 55 0 31 5 74 6 2 1 6 2 89 1 2 * 6 2 94 1 0 * 1 0 0 95 4 * 4 2 97 ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II (Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II) : 69-86 : Автор(ы): Ślósarczyk, W. and I. Wójcik

8. Fishery Report 2017: Exploratory fishery for Dissostichus mawsoni in Subarea 88.2

   the same and has been closed to fishing. 5. In 2013 the Scientific Committee recognised that an ... years fishing in these SSRUs occurred in the south on the continental slope/shelf. 5 ... 2013 2014 Argentina Argenova XXI 8 (0) Chile Isla Eden 5 (0) Korea, Republic ... ) 250 (38) 68 (2) 210 (49) 15 (4) 67 (3) Argos Georgia 182 (21) 9 (1) 58 (13) 13 (5 ...

   Document : Site Section: Publications

9. Fishery Report 2017: Dissostichus eleginoides South Georgia (Subarea 48.3)

   significant bird by-catch, as set out in CM 41-02. 5. In 2017, the fishery was open from 16 April to 14 ... (B and C) refer to the management areas shown in Figure 1. 5 Life-history parameters 12 ... was evidence of a cohort of 5+ fish. 15. All toothfish vessels in Subarea 48.3 carry a CCAMLR ... correction for cetacean depredation varies annually but is typically in the range of a 3% to 5% increase ...

   Document : Site Section: Publications

10. Possible effects of different levels of krill fishing on predators – some initial modelling attempts

    0.69 0.67 0.64 0.64 Age-at-First-Reproduction T (yr) 4 4 5 10 The va lues of t h e p ... biomass is high. Figure 5 shows plots of predator numbers (N) against time for three different values ... is the figure actually used.) The y = 0 plots in Figure 5 indicate that some problems remain with ... ...... , \ median L.:, 90%-ile ', ;.,,.> b. ,L:\, ,, . I , ,L' >: 1 5 / Oeterrnlnlst~c l 10%-~le ...

    Science Journal Paper : CCAMLR Science, Volume 2 (CCAMLR Science, Volume 2) : 79–97 : Автор(ы): Butterworth, D.S. and R.B. Thomson

Страницы