Результаты поиска

1. Conservation Measure Conservation Measure 91-01 (2004)

   for their consideration at least three months before its consideration by WG-EMM. 3. The draft ... Commission as the case may be. 4. If, following completion of the procedures outlined in paragraphs 1 to 3 ... within or over the site. 3. Prohibitions regarding: 3.1 the installation, modification, and/or ...

   Conservation Measure : 91-01 (2004)

2. Conservation Measure Conservation Measure 124/XVI (1997)

   shall be limited to 3 300 tonnes. 2. For the purposes of the fishery for Dissostichus eleginoides in ... , or until the catch limit is reached, whichever is the sooner. 3. Each vessel participating in ...

   Conservation Measure : 124/XVI (1997)

3. Conservation Measure Conservation Measure 41-04 (2012)

   . Season 3. For the purpose of the exploratory longline fishery for Dissostichus spp. in Statistical ... . 6. Any vessel catching a total of three (3) seabirds shall immediately revert to night setting in ...

   Conservation Measure : 41-04 (2012)

4. Conservation Measure Conservation Measure 112/XV (1996)

   Dissostichus eleginoides and D. mawsoni combined in any fine-scale rectangle exceeds 100 tonnes. 3. Any ...

   Conservation Measure : 112/XV (1996)

5. e-sc-im-i.pdf

   ... _______________________ Telephone: 61 3 6210 1111 Facsimile: 61 3 6224 8766 Email: ccamlr@ccamlr.org Website ... ............................................................... 27 Annex 3: List of Documents ................................................................ 43 ... in Annex 3. 1.6 The report of the Scientific Committee was prepared by Drs J. Arata (Chile), C ... 3 and a Spawning Protection Zone. The proposal addressed 10 specific objectives which are application/pdf attached to:SC-CAMLR-SM-I

   Meeting Report : SC-CAMLR-SM-I

6. Can toothfish catches be used to predict the presence of vulnerable benthic invertebrate taxa?

   70° S 65° S 60° S 1 2 3 4 Figure 1: Ross Sea region indicating areas where segment-level ... 91 124 Segments with AXT 10 2 12 12 36 Segments with CSS 2 5 8 173 188 Segments with GGW 9 17 3 58 ... taxa: Pennatulacea (NTW) 1 3 0 21 25 Euryalida (OEQ) 5 7 1 11 24 Cidaroidea (CVD) 1 0 0 11 12 ... Bathylasmatidae (BWY) 0 0 0 3 3 Antipatharia (AQZ) 0 0 0 3 3 Bryozoan (BZN) 0 1 0 1 2 Serpulid (SZS) 0 1 0 0 1 ...

   Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 87–96 : Автор(ы): Parker, S.J. and M.H. Smith

7. Evaluating the impact of multi-year research catch limits on overfished toothfish populations

   60 75 90 1 10 27 28 29 30 31 32 34 2 15 21 22 24 25 26 27 28 3 20 17 17 19* 20 21 22 23 4 25 15 16 ... , should aim to produce an as- sessment within a 3–4 year time frame of research commencing (SC-CAMLR ... stock within a 2–3 decade time frame and thus result in a failure to achieve the objectives of Article ... , SSB0 was 3 530 tonnes or ~71% of B0 in the simu- lated population. Ten years into the projection ...

   Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 47–55 : Автор(ы): Welsford, D.C

8. Guidelines for the preparation of hydroacoustic survey reports on krill

   3XOMeTpHqeCKHX HarrpaBJIeHa Ha rrOBbIllieHHe 33 e ~ OTQET 0 rH~POAKYCTHqECKOB CbEMKE ... /1Y 27-28/1Y 29/1Y-5/Y 6/Y - 172 - BNmeHHOCTHX, KOHTpOnbHHe TpaneHHH, npOMe- pO'IHHe pa60TH ... . rHCTorpaMMa pacnpe- ~eneHHfl ~nHH KpHnH rrpHBe~eHa Ha pHC. 3. ITpOMHCnOBafl 06cTaHoBKa. B nepHo~ pa60TH ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/3 (Selected Scientific Papers, SC-CAMLR-SSP/3) : 165-193 : Автор(ы): Kalikhman, I.L.

9. Biomass, abundance and distribution of fish in the Kerguelen Islands EEZ (CCAMLR Statistical Division 58.5.1)

   del área. Keywords: fish biomass, Kerguelen EEZ, Dissostichus eleginoides, CCAMLR 3 Biomass ... expectation of a survey of about 200 trawls. A minimum distance between stations of 5 n miles (3 n miles for ... catches comprised 63 fish species (two sharks, three skates, 28 near-bottom and 30 mid- water teleosts ... South Skiff Bank Depth (m) 100–500 63 164 27 032 3 117* 500–1 000 38 540 46 965 3 755 Duhamel ...

   Science Journal Paper : CCAMLR Science, Volume 16 (CCAMLR Science, Volume 16) : 1–32 : Автор(ы): Duhamel, G. and M. Hautecoeur

10. Sources of variance in studies of krill population genetics

    Atlantic sector of Antarctic waters and off the Antarctic Peninsula. Polar Biol., 3: 19–28. Sundt, R.C ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ... % bromophenol blue, 10 mM NaOH. These mixtures were placed in a 95ºC heating block for 3 min to denature the ...

    Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Автор(ы): Jarman, S.N. and S. Nicol

Страницы