Résultats de la recherche

1. Sources of variance in studies of krill population genetics

   reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ... an e t a l., 2 00 2 82 m tD N A h ap lo ty pe s 65 , 6 1, 5 9, 4 7 D if fe re ... nd M ac D on al d , 1 98 4 7 al lo zy m e lo ci 29 5, 1 01 , 2 32 , 9 3, 3 59 ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Auteur(s): Jarman, S.N. and S. Nicol

2. Characteristics of seasonal variation in diurnal vertical migration and aggregation of Antarctic krill (Euphausia superba) in the Scotia Sea, using Japanese fishery data

   , T. Hayashi and M. Naganobu National Research Institute of Far Seas Fisheries 5-7-1 Orido, Shimizu ... level 3) × 5 / 6. Results Vertical distribution of trawling depth The average trawling depth in SS ... January, but decreased after February and was at its lowest level (0.17) from April to August (Figure 5 ... M TW SR S M RN DA Y AF T SS T ET W DS K NI T 0 5 10 15 20 25 Jan. 0 20 40 60 NIT DWN ...

   Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 163–172 : Auteur(s): Taki, K., T. Hayashi and M. Naganobu

3. Can we use discriminant function analysis to sex penguins prior to calculating an index of a morphometric characteristic?

   size required in order to be 80% certain of detecting the difference at the 5% level of significance ... ba = k(1l + aa) substituting equation (3) bA = l+kaA substituting equation (4) (5) We can ... and J.L' are widely separated or r is very small. 264 5. THE EFFECT OF SEX RATIO ON COMBINED ... % certain of detecting the difference between true and apparent means at 5% significance level (replicates ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 259–272 : Auteur(s): Agnew, D.J.

4. Krill population biology during the 1991 Chilean Antarctic krill fishery

   area approximately 40 x 40 m), which was towed at a mean velocity of 2.65 knots for 5 to 95 minutes ... the largest modes between 46 and 47 mm TL (Figure 5). The analysis of the size frequency ... 7 6 % F 5 r 9 4 q u3 e n ~~~ o_~"~·~e:m.,es c 2 y 1 20 23 26 29 32 35 38 41 44 47 ... ~fffffffffffffffffffffffffTfiTfiTfl11/ 20 23 26 29 32 35 38 41 44 47 50 53 56 Total length (mm) Figure 5: Size frequency ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 223–235 : Auteur(s): Mujica R., A., E. Acuña S. and A. Rivera O.

5. Estimating the impact of depredation by killer whales and sperm whales on longline fishing for toothfish (Dissostichus eleginoides) around South Georgia

   (Figure 5). In order to estimate the impact of cetacean dep- redation on total extractions, the declared ... , because the proportion of sets where they are present is between 3 and 5%. Over the seven years of study ... 66 9 4 67 1 4 67 1 20 05 3. 4% 5. 1% 8. 1% 3 05 7 3 16 0 3 21 3 3 ... 30 3 20 06 4. 2% 4. 9% 4. 4% 3 53 5 3 68 3 3 70 7 3 69 0 20 07 3. 8 ...

   Science Journal Paper : CCAMLR Science, Volume 17 (CCAMLR Science, Volume 17) : 163–178 : Auteur(s): Moir Clark, J. and D.J. Agnew

6. Results of fish larvae sampling by means of fine-meshed samplers attached to a bottom trawl

   samples taken during the period 4 February-5 March 1986. In the bottom samples collected during this ... 320 0 612 40 280 2 514 1 0 180 0 128 1 0 560 5 2 1 0 170 0 32 4 320 6 2 na na 0 6 350 510 3 0 ... 0.505 mm mm X A B C 0 X A B C 0 19 0 0 20 0 612 21 * 5 22 2 514 23 0 0 24 0 128 25 5 2 26 0 ... 256 42 56 64 67 1 6 2 58 0 68 55 0 31 5 74 6 2 1 6 2 89 1 2 * 6 2 94 1 0 * 1 0 0 95 4 * 4 2 97 ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II (Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II) : 69-86 : Auteur(s): Ślósarczyk, W. and I. Wójcik

7. Fishery Report 2017: Exploratory fishery for Dissostichus mawsoni in Subarea 88.2

   the same and has been closed to fishing. 5. In 2013 the Scientific Committee recognised that an ... years fishing in these SSRUs occurred in the south on the continental slope/shelf. 5 ... 2013 2014 Argentina Argenova XXI 8 (0) Chile Isla Eden 5 (0) Korea, Republic ... ) 250 (38) 68 (2) 210 (49) 15 (4) 67 (3) Argos Georgia 182 (21) 9 (1) 58 (13) 13 (5 ...

   Document : Site Section: Publications

8. Fishery Report 2017: Dissostichus eleginoides South Georgia (Subarea 48.3)

   significant bird by-catch, as set out in CM 41-02. 5. In 2017, the fishery was open from 16 April to 14 ... (B and C) refer to the management areas shown in Figure 1. 5 Life-history parameters 12 ... was evidence of a cohort of 5+ fish. 15. All toothfish vessels in Subarea 48.3 carry a CCAMLR ... correction for cetacean depredation varies annually but is typically in the range of a 3% to 5% increase ...

   Document : Site Section: Publications

9. Possible effects of different levels of krill fishing on predators – some initial modelling attempts

   0.69 0.67 0.64 0.64 Age-at-First-Reproduction T (yr) 4 4 5 10 The va lues of t h e p ... biomass is high. Figure 5 shows plots of predator numbers (N) against time for three different values ... is the figure actually used.) The y = 0 plots in Figure 5 indicate that some problems remain with ... ...... , \ median L.:, 90%-ile ', ;.,,.> b. ,L:\, ,, . I , ,L' >: 1 5 / Oeterrnlnlst~c l 10%-~le ...

   Science Journal Paper : CCAMLR Science, Volume 2 (CCAMLR Science, Volume 2) : 79–97 : Auteur(s): Butterworth, D.S. and R.B. Thomson

10. Long-term monitoring of krill recruitment and abundance indices in the Elephant Island area (Antarctic Peninsula)

    Number of Hauls 16 14 17 9 33 36 105 25 14 70 5 0 8 6 3 7 41 42 3 9 6 8 72 6 8 6 6 ... for the Elephant Island area, however, the proportional recruitment index R, differs by less than 5 ... often the results differ by more than 10%, while the difference is generally less than 5% for the R ... re-sampling (500 permutations are adequate for a significance level of 0.05 and 5 000 for a level of ...

    Science Journal Paper : CCAMLR Science, Volume 4 (CCAMLR Science, Volume 4) : 19–35 : Auteur(s): Siegel, V., W. de la Mare and V. Loeb

Pages