Résultats de la recherche

1. Conservation Measure Conservation Measure 214/XIX (2000)

   experimental harvest regime up to 30 June 2001 shall be submitted to CCAMLR by 31 August 2001. 3. Normal ...

   Conservation Measure : 214/XIX (2000)

2. e-sc-im-i.pdf

   ... _______________________ Telephone: 61 3 6210 1111 Facsimile: 61 3 6224 8766 Email: ccamlr@ccamlr.org Website ... ............................................................... 27 Annex 3: List of Documents ................................................................ 43 ... in Annex 3. 1.6 The report of the Scientific Committee was prepared by Drs J. Arata (Chile), C ... 3 and a Spawning Protection Zone. The proposal addressed 10 specific objectives which are application/pdf attached to:SC-CAMLR-SM-I

   Meeting Report : SC-CAMLR-SM-I

3. Can toothfish catches be used to predict the presence of vulnerable benthic invertebrate taxa?

   . Hydro- biologia, 471: 19–28. Hourigan, T.F., S.E. Lumsden, G. Dorr, A.W. Bruckner, S. Brooke and R.P ... . Document WG-EMM-10/28. CCAMLR, Hobart, Australia: 18 pp. SC-CAMLR. 2009. Report of the Workshop on ... 70° S 65° S 60° S 1 2 3 4 Figure 1: Ross Sea region indicating areas where segment-level ... 91 124 Segments with AXT 10 2 12 12 36 Segments with CSS 2 5 8 173 188 Segments with GGW 9 17 3 58 ...

   Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 87–96 : Auteur(s): Parker, S.J. and M.H. Smith

4. Evaluating the impact of multi-year research catch limits on overfished toothfish populations

   60 75 90 1 10 27 28 29 30 31 32 34 2 15 21 22 24 25 26 27 28 3 20 17 17 19* 20 21 22 23 4 25 15 16 ... , should aim to produce an as- sessment within a 3–4 year time frame of research commencing (SC-CAMLR ... stock within a 2–3 decade time frame and thus result in a failure to achieve the objectives of Article ... , SSB0 was 3 530 tonnes or ~71% of B0 in the simu- lated population. Ten years into the projection ...

   Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 47–55 : Auteur(s): Welsford, D.C

5. Guidelines for the preparation of hydroacoustic survey reports on krill

   /1Y 27-28/1Y 29/1Y-5/Y 6/Y - 172 - BNmeHHOCTHX, KOHTpOnbHHe TpaneHHH, npOMe- pO'IHHe pa60TH ... 12 16 20 24 28 32 36 40 r, I I I 1 r\1 I 1/ - ... 1 I \J I I~ I I I 1'\1/ V I I I ----i-"" I ... 3XOMeTpHqeCKHX HarrpaBJIeHa Ha rrOBbIllieHHe 33 e ~ OTQET 0 rH~POAKYCTHqECKOB CbEMKE ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/3 (Selected Scientific Papers, SC-CAMLR-SSP/3) : 165-193 : Auteur(s): Kalikhman, I.L.

6. Biomass, abundance and distribution of fish in the Kerguelen Islands EEZ (CCAMLR Statistical Division 58.5.1)

   catches comprised 63 fish species (two sharks, three skates, 28 near-bottom and 30 mid- water teleosts ... del área. Keywords: fish biomass, Kerguelen EEZ, Dissostichus eleginoides, CCAMLR 3 Biomass ... expectation of a survey of about 200 trawls. A minimum distance between stations of 5 n miles (3 n miles for ... South Skiff Bank Depth (m) 100–500 63 164 27 032 3 117* 500–1 000 38 540 46 965 3 755 Duhamel ...

   Science Journal Paper : CCAMLR Science, Volume 16 (CCAMLR Science, Volume 16) : 1–32 : Auteur(s): Duhamel, G. and M. Hautecoeur

7. Sources of variance in studies of krill population genetics

   Atlantic sector of Antarctic waters and off the Antarctic Peninsula. Polar Biol., 3: 19–28. Sundt, R.C ... nt ia ti on K üh l a nd S ch ne pp en he im , 1 98 6 8 al lo zy m e lo ci 28 4 ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Auteur(s): Jarman, S.N. and S. Nicol

8. On the intensity of sampling krill trawl catches

   Orkneys, and (b) Elephant Island. \0 E 28 100 £. « w 26 '" « fu 24 :r: 13 22 Z w ..... Z ... ~ ..... Figure 5: _ 30r 100\ (a) South Orkneys (b) Elephant island 1 28 3 ... Figures 2 and 3. Again significant differences were found between mean lengths by station at both the ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/7 (Selected Scientific Papers, SC-CAMLR-SSP/7) : 29–48 : Auteur(s): Miller, D.G.M.

9. Scientific Abstracts 2008

   initiation dates for four penguin breeding sites are examined (Cape Shirreff, Livingston Island (62°28'S, 60 ... accuracy of the model. These cross-validation methods showed that the fitted relationships explained 28 ... in the High Seas. CCAMLR Secretariat, 4 pp. (English, unpublished). 3 http://www.taaf.fr ... , Australia, john.mckinlay@aad.gov.au), 3 pp. (English, unpublished). In addition to a review of published ...

   Document : Site Section: Publications

10. Conservation Measure Conservation Measure 21-03 (2009)

    the licence to the vessel concerned. 3. A Member intending to fish for krill in the Convention Area ... technique Expected proportion of time to be used (%) 1 2 3 4 5 … Total 100 ... extremity into the mesh opening in a direction perpendicular to the plane of the net. 3. The gauge shall ... it is stopped at the tapering edges by the resistance of the mesh. ARTICLE 3 Selection of Meshes ...

    Conservation Measure : 21-03 (2009)

Pages