Search results

1. Schedule of Conservation Measures in Force 2006/07

   ).......................... 5 Annex 10-04/A ............................................................................ 10 ...

   Document : Site Section: Publications

2. Scientific Abstracts 2003

   during the summer (a 5% decrease from last season), 90 fewer items were collected throughout the winter ... , 13 to 23 October 2003 (SC-CAMLR-XXII, Annex 5). Working Group on Fish Stock Assessment, 46 pp ... fisheries management. WG-EMM-03/5 The use of Antarctic shags to monitor coastal fish populations ... _________________________________________________________________________________________ ________________________________________________________________________________________ 5 ...

   Document : Site Section: Publications

3. The sensitivity of multiple output statistics to input parameters in a krill–predator–fishery ecosystem dynamics model

   Matrix 1 18 5 90 1 Vector or matrix length is the number of relevant modelled areas, except for time ... s ji t j t j h sh j t j h sh v T Z v Z v ® ® ® = + - - - å å (5) is the number of ... perturbation-response combi- nations (Table 5). The perturbation produced a negative response (i.e. reduced ... 0.107 0.233 4 48.1 0.924 0.337 0.176 0.222 0.306 5 48.1 1.864 0.448 0.213 0.255 0.384 6 48.1 1.370 ...

   Science Journal Paper : CCAMLR Science, Volume 20 (CCAMLR Science, Volume 20) : 97–118 : Author(s): Hill, S.L. and J. Matthews

4. The CCAMLR-2000 Krill Synoptic Survey: a description of the rationale and design

   Far Sea Fisheries 5-7-1 Orido, Shimizu, Shizuoka, 424-8633, Japan V. Sushin and S.M. Kasatkina ... AtlantNIRO 5 Dmitry Donskoy Street Kaliningrad 236000, Russia S. Hedley Research Unit for Wildlife ... . The random sliifts for the grids are shown in Table 4. Table 5: Parameters used for the ... . Vessel Priority for Omission 1 2 3 4 5 6 7 8 9 10 Ship 1 (large-scale) Ship 2 (large-scale) Ship 2 ...

   Science Journal Paper : CCAMLR Science, Volume 8 (CCAMLR Science, Volume 8) : 1–23 : Author(s): Trathan, P.N., J.L. Watkins, A.W.A. Murray, A.S. Brierley, I. Everson, C. Goss, J. Priddle, K. Reid, P. Ward, R. Hewitt, D. Demer, M. Naganobu, S. Kawaguchi, V. Sushin, S.M. Kasatkina, S. Hedley, S. Kim and T. Pauly

5. Surface water circulation in krill fishing areas near the South Shetland Islands

   . Naganobu National Research Institute of Far Seas Fisheries 5-7-1, Orido, Shimizu, 424 Japan Abstract ... were re-calculated for each 5' latitude X 10' longitude block (5 X 5 n miles) for each month of the ... exhibited different patterns for these three regions (Figure l). Buoys 1 and 5 deployed in the oceanic ... northern shelf break. Buoys 1, 5 and 6 which travelled across the Scotia Sea to South Georgia and the ...

   Science Journal Paper : CCAMLR Science, Volume 3 (CCAMLR Science, Volume 3) : 125–136 : Author(s): Ichii, T. and M. Naganobu

6. Sources of variance in studies of krill population genetics

   reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ... an e t a l., 2 00 2 82 m tD N A h ap lo ty pe s 65 , 6 1, 5 9, 4 7 D if fe re ... nd M ac D on al d , 1 98 4 7 al lo zy m e lo ci 29 5, 1 01 , 2 32 , 9 3, 3 59 ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Author(s): Jarman, S.N. and S. Nicol

7. Characteristics of seasonal variation in diurnal vertical migration and aggregation of Antarctic krill (Euphausia superba) in the Scotia Sea, using Japanese fishery data

   , T. Hayashi and M. Naganobu National Research Institute of Far Seas Fisheries 5-7-1 Orido, Shimizu ... level 3) × 5 / 6. Results Vertical distribution of trawling depth The average trawling depth in SS ... January, but decreased after February and was at its lowest level (0.17) from April to August (Figure 5 ... M TW SR S M RN DA Y AF T SS T ET W DS K NI T 0 5 10 15 20 25 Jan. 0 20 40 60 NIT DWN ...

   Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 163–172 : Author(s): Taki, K., T. Hayashi and M. Naganobu

8. Can we use discriminant function analysis to sex penguins prior to calculating an index of a morphometric characteristic?

   size required in order to be 80% certain of detecting the difference at the 5% level of significance ... ba = k(1l + aa) substituting equation (3) bA = l+kaA substituting equation (4) (5) We can ... and J.L' are widely separated or r is very small. 264 5. THE EFFECT OF SEX RATIO ON COMBINED ... % certain of detecting the difference between true and apparent means at 5% significance level (replicates ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 259–272 : Author(s): Agnew, D.J.

9. Krill population biology during the 1991 Chilean Antarctic krill fishery

   area approximately 40 x 40 m), which was towed at a mean velocity of 2.65 knots for 5 to 95 minutes ... the largest modes between 46 and 47 mm TL (Figure 5). The analysis of the size frequency ... 7 6 % F 5 r 9 4 q u3 e n ~~~ o_~"~·~e:m.,es c 2 y 1 20 23 26 29 32 35 38 41 44 47 ... ~fffffffffffffffffffffffffTfiTfiTfl11/ 20 23 26 29 32 35 38 41 44 47 50 53 56 Total length (mm) Figure 5: Size frequency ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 223–235 : Author(s): Mujica R., A., E. Acuña S. and A. Rivera O.

10. Conservation Measure Conservation Measure 24-01 (2017)

    4 and 5), and any exemptions pursuant to Annex 24-01/A, format 2, that are agreed by the Commission ... complete C1 data. 24-01 5. Other requirements for these research activities are: (a) All vessels ... dependent and related species and the likelihood of their being affected by the proposed fishery. 5 ... for finfish taxa Dissostichus spp. Longline 5 tonnes Trawl 5 tonnes Pot 5 tonnes Other 0 ...

    Conservation Measure : 24-01 (2017)

Pages