Главная Главная

CCAMLR

Комиссия по сохранению морских живых ресурсов Антарктики

  • Главная
  • Перейти к контенту сайта
  • Вход
  • Моя учетная запись

Форма поиска

  • Об АНТКОМ
  • Меры по сохранению
  • Наука
  • Промыслы
  • Соблюдение
  • Данные
  • Совещания
  • Публикации
  • Циркуляры
  • English
  • Français
  • Русский
  • Español
  • Главная
  • Page not found
Print this page
Increase font size
Decrease font size

Page not found

Сообщение об ошибке

The page you requested does not exist. For your convenience, a search was performed using the query system files CCAMLR VME Registry 09022022 3 xlsx.
Advanced Search

Результаты поиска

  1. Fishery Report: Dissostichus eleginoides South Georgia (Subarea 48.3)

    distribution of catches (time series) ......................................... 3 2. Stocks and areas ... ......................................................................... 4 3. Parameters and available data .......................................................... 4 ... 100 tonnes respectively, with an overall catch limit for SGSR of 3 000 tonnes. The total declared ... >1 fish per tonne with a total of 2 968 fish tagged (with 737 recaptures). 3. Most catch has been ...

    Document : Site Section: Publications

  2. Sources of variance in studies of krill population genetics

    regions therefore can not be adequately assessed unless multiple samples are taken from each region. File ... 07 jarman-nicol PROOF for pdf.indd CCAMLR Science ... . Keywords: krill, DNA, sample, genetics, population, CCAMLR 109 Sources of variance in studies of krill ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ...

    Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Автор(ы): Jarman, S.N. and S. Nicol

  3. Characteristics of seasonal variation in diurnal vertical migration and aggregation of Antarctic krill (Euphausia superba) in the Scotia Sea, using Japanese fishery data

    visual predators. File:  09taki-etal.pdf ... 09 taki et al proof.indd CCAMLR Science, Vol. 12 ... shery data, Scotia Sea, trawling depth, vertical distribution, CCAMLR 165 Vertical migration and ... ; level 3 – dark green. The feeding index for each tow was calcu lated as (occurrence of frequency (%) of ... level 3) × 5 / 6. Results Vertical distribution of trawling depth The average trawling depth in SS ...

    Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 163–172 : Автор(ы): Taki, K., T. Hayashi and M. Naganobu

  4. Fishery Report: Champsocephalus gunnari South Georgia (Subarea 48.3)

    ......................................................................... 2 3. Parameter estimation ................................................................... 3 ... 3.1 Estimation methods ................................................................ 3 ... Acoustic surveys ................................................................... 3 Trawl surveys ... ....................................................................... 3 Standing stock ...................................................................... 3 ...

    Document : Site Section: Publications

  5. An index of per capita recruitment

    Islands from 1979 to 1998 is presented. File:  11hewitt.pdf ... Short Notes CCAMLR Science, Vol. 7 (2000): 179-196 ... ) echantillonne a proximite des iles Shetland du Sud de 1979 a 1998. B cTaTbe npennomeH cnenymq~i? n o ~ a 3 a ... HJIM II0 rOnaM; (ii) HepeCTHTCR 100% ~ - J I ~ T H M x oco6efi; (iii) clMeeTcx p e n p e 3 e ~ ~ a ... , nOrHOpMaJIbHOe H PaBHOMepHOe paCIIpeneneHHR ~ e p o s r ~ ~ o c ~ e t i R1 H 3 ~ H ~ Y ~ H H R M. P a c n p e ...

    Science Journal Paper : CCAMLR Science, Volume 7 (CCAMLR Science, Volume 7) : 179–196 : Автор(ы): Hewitt, R

  6. The utilization of seabird censuses for krill monitoring

    databases, calling for international cooperation on the subject. File:  16-Marschoff-et-al.pdf ... necessary complement to the land-based monitoring programs being developed by CCAMLR members and can ... purpose of krill abundance monitoring. Bearing in mind the concept of the CCAMLR Working Group on ... consequence of the selection of orthogonal functions as components of vector a'. 11; 3. As _! [fi(t)-fj(t ... was highly abundant 2) Sightings where krill was abundant 3) Sightings where krill was scarce or ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/4 (Selected Scientific Papers, SC-CAMLR-SSP/4) : 393-425 : Автор(ы): Marschoff, E.R., J.G. Visbeek and L.R. Fontana

  7. Validation of sink rates of longlines measured using two different methods

    archival nature of the data collected. File:  12wienecke-robertson.pdf ... wienecke-robertson proof.indd CCAMLR Science, Vol ... recently required by CCAMLR to achieve longline sink rates of 0.3 m.s–1 to a depth of 15 m (Conservation ... Measure 24-02, see CCAMLR, 2002). In principle, there are two methods of measuring sink rates: time ... , evaluation of methods, CCAMLR 181 Validation of longline sink rates of advantages that bottles have over ...

    Science Journal Paper : CCAMLR Science, Volume 11 (CCAMLR Science, Volume 11) : 179–187 : Автор(ы): Wienecke, B. and G. Robertson

  8. By-catch of fish in the krill fishery

    areas of the South Georgia shelf. The problem is thought to be least in open ocean krill fishing. File ... Museum, USSR Academy of Sciences, 199034 Leningrad, USSR 3 VN1RO, 17a V. Krasnoselskaya, 107140 Moscow ... estimated total number or weight for the haul. 3. RESULTS Information on individual net hauls from both ... cruises is set out in Tables 3 to 4 for Subareas 48.3, 48.2 and 48.6 respectively. Estimated numbers of ... fishing in the southwest Atlantic. Antarctic Science, Vol. 3. FROLKINA, ZH.A. 1989. Methods of age ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/8 (Selected Scientific Papers, SC-CAMLR-SSP/8) : 381–401 : Автор(ы): Everson, I., A. Neyelov and Y.B. Permitin

  9. Some comments on the procedure for testing estimators of krill abundance which utilise survey data

    suggestions are made in this regard. File:  11-Butterworth-et-al.pdf ... Ha MeTO,lle Kpatira), HanpaBJIeHHble Ha MO,lleJIHpOBaHHe nO,llo6Hb1X 333 ... exponential: (3) Though this is the same form as fitted by Miller and Hampton (1989a) to these data, the ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/8 (Selected Scientific Papers, SC-CAMLR-SSP/8) : 191–205 : Автор(ы): Butterworth, D.S., D.L. Borchers and D.G.M. Miller

  10. Notothenia (P.) guntheri stock status and TAC estimation in the area of Shag Rocks (Subarea 48.3)

    unchanged. File:  03-Shust-and-Borodin.pdf ... , CCAMLR, 1985), CqHTaeM HenpaBHJIbHbIM. IIo HaIIIeMY MHeHHIO, 3a OC065IMH 3TOti nonYJI5I~HH patioHa CKaJI ... O-Ba 10. reOprH5I OCo6H 3Toro BH,l(a 3a 20 JIeT perYJI5IpHO npoBO,l(HMbIX 3,l(eCb COBeTCKHX H ... patioHe CKaJI IIIar )l{eJITOn epKa 5IBJI5IeTC5I ,l(OMHHHPYIOIQHM BH,l(OM H ee qHCJIeHHOCTb 3,l(eCb OqeHb ... , nOJIOBOe C03peBaHlle oco6eH 06011X nOJIOB npOllCXO,l{IlT Y)I{e Ha 3 ro,l{Y )l{1l3Hll, a B B03pacTe 3 JIeT ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II (Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II) : 53-68 : Автор(ы): Shust, K. and R. Borodin

Страницы

  • « первая
  • ‹ предыдущая
  • …
  • 821
  • 822
  • 823
  • 824
  • 825
  • 826
  • 827
  • 828
  • 829
  • …
  • следующая ›
  • последняя »

Контакты

E-mail: ccamlr [at] ccamlr [dot] org
Телефон: +61 3 6210 1111
Факс: +61 3 6224 8744
Адрес: 181 Macquarie Street, Hobart, 7000, Tasmania, Australia

 

Быстрые ссылки

  • Вакансии
  • Лицензированные суда
  • Список действующих мер по сохранению 2024/25 г.
  • Достижения АНТКОМ

Current and Upcoming Meetings

  • WG-FSA-2025
  • SCIC-2025
  • SC-CAMLR-44
  • CCAMLR-44
  • SCAF-2025

Footer Links Russian

  • Вход
  • Веб-почта
  • Обсуждения АНТКОМ
  • э-группы АНТКОМ
  • Служба поддержки
  • Авторское право
  • Отказ от ответственности и конфиденциальность
  • Карта веб-сайта
© Copyright - the Commission for the Conservation of Antarctic Marine Living Resources 2025, Все права защищены.  |  Наверх  |  Сайт разработан компанией Eighty Options