Главная Главная

CCAMLR

Комиссия по сохранению морских живых ресурсов Антарктики

  • Главная
  • Перейти к контенту сайта
  • Вход
  • Моя учетная запись

Форма поиска

  • Об АНТКОМ
  • Меры по сохранению
  • Наука
  • Промыслы
  • Соблюдение
  • Данные
  • Совещания
  • Публикации
  • Циркуляры
  • English
  • Français
  • Русский
  • Español
  • Главная
  • Page not found
Print this page
Increase font size
Decrease font size

Page not found

Сообщение об ошибке

The page you requested does not exist. For your convenience, a search was performed using the query system files CCAMLR VME Registry 07122022v3 3 xlsx.
Advanced Search

Результаты поиска

  1. Trends in population size and breeding success at colonies of macaroni and rockhopper penguins, Marion Island, 1979/80–1995/96

    that factors influencing the reproductive performance of the two species are not the same. File ... CCAMLR Science, Vol. 4 (1997): 89-103 TRENDS IN ... BCerO nepMOAa MCCJIeAOBaHklX YMCJIeHHoCTb ca~0f i ~pyI I~0f i M 3 TpeX H3yYaBLIIMXCII K O J I O H M ... KOnMYeCTBa pa3MHOXaK)wMXCII nap B 0 BCeX KOJIOHMRX - 3 T 0 OTPMuaTeJIbHaR KOpPenRQMII MeXJJy ABYMX ... COCCAHMMM KOJIOHMRMM, Y T O rOBOpHT 0 B O 3 M O X H b I X MMrpaUMRX MeXAy KOJIOHRIIMA. 3a BeCb IIepMOn ...

    Science Journal Paper : CCAMLR Science, Volume 4 (CCAMLR Science, Volume 4) : 89–103 : Автор(ы): Cooper, J., A.C. Wolfaardt and R.J.M. Crawford

  2. Optimization of survey sampling design in the detection of interannual variability and prey size selectivity in the diet of penguins

    errors fixed at 0.1. Cost values of manpower required are based on Argentinian logistics. File:  34 ... -dates" interaction. Taking account of the 1989 deliberations of the Working Group for the CCAMLR ... values for the variance components and their 80% confidence intervals have been extracted from Table 3 ... confidence intervals respectively: = 2.63 ~ 3 = 25.03 :::; 26 A 10% change in the mean of two years ... analysis. 3. JESTING PENGUIN SELECTIVITY If extant, size selectivity of krill by penguins will result ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/7 (Selected Scientific Papers, SC-CAMLR-SSP/7) : 551–559 : Автор(ы): Marschoff, E. and B. Gonzalez

  3. Population genetic structure of Patagonian toothfish in the West Indian Ocean sector of the Southern Ocean

    fishing locations. File:  02appleyard-etal.pdf ... appleyard et al proof.indd CCAMLR Science, Vol. 11 ... the area of application of CCAMLR. Little is known about the stock structure or degree of stock ... , CCAMLR 23 Population genetic structure of Patagonian toothfi sh case, the genetic differentiation ... of the Southern Ocean. A number of countries fi sh in both CCAMLR and national fi shing grounds ...

    Science Journal Paper : CCAMLR Science, Volume 11 (CCAMLR Science, Volume 11) : 21–32 : Автор(ы): Appleyard, S.A., R. Williams and R.D. Ward

  4. Homogeneity of Adélie penguins as krill samplers

    factors pertaining to the predator. File:  15-Marschoff-and-Gonzalez.pdf ... BapHal1,HH (-0,26) He~ OTJIW-IaJIC5I 3Ha4HTeJIbHO OT HyJI5I (F=0,093; 3 = 0,54). 3TOT pe3YJIbTaT nO,ll ... values of c until a significant result was obtained. 254 3. RESULTS A total of 11 marked Ad6lie ... (SC-CAMLR-SSP/6). CCAMLR, Hobart, Australia: 367-376. MARSCHOFF, E. and B.N. GONZALEZ. 1990 ... in the diet of penguins. In: Selected Scientific Papers, 1990 (SC-CAMLR-SSPI7). CCAMLR, Hobart ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 253–257 : Автор(ы): Marschoff, E. and B. Gonzalez

  5. Evaluation of the results of trawl selectivity experiments by Poland, Spain and USSR in 1978/79, 1981/82 and 1986/87

    commercial fishery in Statistical Area 48. File:  13-Slosarczyk-et-al.pdf ... codends on Antarctic fish were evaluated in the light of additional information presented to the CCAMLR ... Committee of CCAMLR (8alguerias, 1988; Efanov et al., 1989; Zaucha, 1986 and 1988). 2. COMMENTS ON ... properly evaluated on the basis of available data. Polish hauls of 2 to 3 hours resulted in some cases in ... (Figure 3; see also Table 1.1 of the Appendix). Similarly, no clear relationship was observed between SF ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/6 (Selected Scientific Papers, SC-CAMLR-SSP/6) : 163–196 : Автор(ы): Slosarczyk, W., E. Balguerias, K. Shust and S. Iglesias

  6. Analysis of krill trawling positions north of the South Shetland Islands (Antarctic Peninsula area), 1980/81–1999/2000

    effect. File:  02kawaguchi-segawa.pdf ... ecosystem. CCAMLR Science, 3: 13-30. Ichii, T. 2000. Krill harvesting. In: Everson, I. (Ed.). Krill ... CCAMLR Scie~~ce, Vol. 8 (2001): 25-36 ANALYSIS OF ... , TO MecTa TpaneHm B OCHOBHOM 3 a ~ ~ c e n ~ OT pacnpegeneHMx 6onee KpynHoro, nonoeospenoro KpHJIR ... sene~oro K ~ M I I X ) , Tatime o ~ a 3 b r ~ a n ~ ~ o s p a c ~ a l o ~ e e BnMxHHe Ha MecTa ...

    Science Journal Paper : CCAMLR Science, Volume 8 (CCAMLR Science, Volume 8) : 25–36 : Автор(ы): Kawaguchi, S. and K. Segawa

  7. Age determination of Champsocephalus gunnari Lönnberg, 1905 (Channichthyidae) taken in the South Georgia area in 1990

    /86 year classes. The first small peak corresponds with the strong 1988 year class. File:  17 ... to analogous UK data from the Hill Cove cruise. 286 3. DISCUSSION An analysis of age/length ... gunnari from a range of age classes. CCAMLR/86/FA/12. Hobart, Australia. p. 12. KOCK, K.-H. 1981 ... and biology of Chaenichthyids from South Georgia. Nytt Magaz. Zool., 3: 79-93. Oslo. PANNELLA, G ... rossii from South Georgia. SC-CAMLR-VI/BG/43: 1-43. Hobart, Australia: CCAMLR. . RADTKE, RL. and D.J ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/7 (Selected Scientific Papers, SC-CAMLR-SSP/7) : 285–293 : Автор(ы): Kochkin, P.N.

  8. Letter from the Co-conveners

    WG-FSA (CCAMLR-XXXVII, paragraph 5.30). These include topics such as further development and ... ccamlr@ccamlr.org, Steve.Parker@niwa.co.nz and clara.peron@mnhn.fr by 30 April 2019. A revised draft ... 0900h Hobart time (Australian Eastern Standard Time) on 3 June 2019. We look forward to seeing you ...

    Document : Site Section: Meetings

  9. Fishery Report: Dissostichus eleginoides South Georgia (Subarea 48.3)

    distribution of catches (time series) ......................................... 3 2. Stocks and areas ... ......................................................................... 4 3. Parameters and available data .......................................................... 4 ... 100 tonnes respectively, with an overall catch limit for SGSR of 3 000 tonnes. The total declared ... >1 fish per tonne with a total of 2 968 fish tagged (with 737 recaptures). 3. Most catch has been ...

    Document : Site Section: Publications

  10. Sources of variance in studies of krill population genetics

    regions therefore can not be adequately assessed unless multiple samples are taken from each region. File ... 07 jarman-nicol PROOF for pdf.indd CCAMLR Science ... . Keywords: krill, DNA, sample, genetics, population, CCAMLR 109 Sources of variance in studies of krill ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ...

    Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Автор(ы): Jarman, S.N. and S. Nicol

Страницы

  • « первая
  • ‹ предыдущая
  • …
  • 820
  • 821
  • 822
  • 823
  • 824
  • 825
  • 826
  • 827
  • 828
  • …
  • следующая ›
  • последняя »

Контакты

E-mail: ccamlr [at] ccamlr [dot] org
Телефон: +61 3 6210 1111
Факс: +61 3 6224 8744
Адрес: 181 Macquarie Street, Hobart, 7000, Tasmania, Australia

 

Быстрые ссылки

  • Вакансии
  • Формы данных АНТКОМ
  • Лицензированные суда
  • Список действующих мер по сохранению 2024/25 г.

Current and Upcoming Meetings

Footer Links Russian

  • Вход
  • Веб-почта
  • Обсуждения АНТКОМ
  • э-группы АНТКОМ
  • Служба поддержки
  • Авторское право
  • Отказ от ответственности и конфиденциальность
  • Карта веб-сайта
© Copyright - the Commission for the Conservation of Antarctic Marine Living Resources 2026, Все права защищены.  |  Наверх  |  Сайт разработан компанией Eighty Options