Результаты поиска

1. Discrimination of Macrourus whitsoni and M. caml (Gadiformes, Macrouridae) using otolith morphometrics

   study. SSRU M. whitsoni M. caml 881B 5 19 881C 61 48 881H 67 80 881J 4 19 881K 16 33 882H 67 ... total length (Figure 4) and fish age (Figure 5) but there was little change in otolith shape (roundness ... also larger than otoliths of M. whitsoni for fish of the same age (Figure 5). Otoliths of M. whitsoni ... morphometrics are given in Table 5. Discussion The spatial scale of the sampling used in this study was set ...

   Science Journal Paper : CCAMLR Science, Volume 22 (CCAMLR Science, Volume 22) : 15–28 : Автор(ы): Pinkerton, M.H., C. Ó Maolagáin, J. Forman and P. Marriott

2. Abundance, size and maturity of krill (Euphausia superba) in the krill fishing ground of Subarea 48.1 during the 1990/91 austral summer

   Institute of Far Seas Fisheries, Orido 5-7-1, Shimizu, Shizuoka, 424 Japan 183 184 tourbillons ... SUlVey Region Figure 5 shows the distribution of krill density along the transects. Krill density ... Neritic 10.3 28.1 47.3 15.9 289 5018 163 24 9 Nearshore 2.1 135.1 2020.6 124.8 284 8911 262 33 5 Total ... ' " \ II{-, \ • )'5\:'\:;:" '::ii;~ili:V ' ...... J \" ~~, \ ;I; .... ·::·.1:·: .. ,K ....... .-:11 ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 183–199 : Автор(ы): Ichii, T., H. Ishii and M. Naganobu

3. The sensitivity of multiple output statistics to input parameters in a krill–predator–fishery ecosystem dynamics model

   Matrix 1 18 5 90 1 Vector or matrix length is the number of relevant modelled areas, except for time ... s ji t j t j h sh j t j h sh v T Z v Z v ® ® ® = + - - - å å (5) is the number of ... perturbation-response combi- nations (Table 5). The perturbation produced a negative response (i.e. reduced ... 0.107 0.233 4 48.1 0.924 0.337 0.176 0.222 0.306 5 48.1 1.864 0.448 0.213 0.255 0.384 6 48.1 1.370 ...

   Science Journal Paper : CCAMLR Science, Volume 20 (CCAMLR Science, Volume 20) : 97–118 : Автор(ы): Hill, S.L. and J. Matthews

4. The CCAMLR-2000 Krill Synoptic Survey: a description of the rationale and design

   Far Sea Fisheries 5-7-1 Orido, Shimizu, Shizuoka, 424-8633, Japan V. Sushin and S.M. Kasatkina ... AtlantNIRO 5 Dmitry Donskoy Street Kaliningrad 236000, Russia S. Hedley Research Unit for Wildlife ... . The random sliifts for the grids are shown in Table 4. Table 5: Parameters used for the ... . Vessel Priority for Omission 1 2 3 4 5 6 7 8 9 10 Ship 1 (large-scale) Ship 2 (large-scale) Ship 2 ...

   Science Journal Paper : CCAMLR Science, Volume 8 (CCAMLR Science, Volume 8) : 1–23 : Автор(ы): Trathan, P.N., J.L. Watkins, A.W.A. Murray, A.S. Brierley, I. Everson, C. Goss, J. Priddle, K. Reid, P. Ward, R. Hewitt, D. Demer, M. Naganobu, S. Kawaguchi, V. Sushin, S.M. Kasatkina, S. Hedley, S. Kim and T. Pauly

5. Surface water circulation in krill fishing areas near the South Shetland Islands

   . Naganobu National Research Institute of Far Seas Fisheries 5-7-1, Orido, Shimizu, 424 Japan Abstract ... were re-calculated for each 5' latitude X 10' longitude block (5 X 5 n miles) for each month of the ... exhibited different patterns for these three regions (Figure l). Buoys 1 and 5 deployed in the oceanic ... northern shelf break. Buoys 1, 5 and 6 which travelled across the Scotia Sea to South Georgia and the ...

   Science Journal Paper : CCAMLR Science, Volume 3 (CCAMLR Science, Volume 3) : 125–136 : Автор(ы): Ichii, T. and M. Naganobu

6. Sources of variance in studies of krill population genetics

   reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ... an e t a l., 2 00 2 82 m tD N A h ap lo ty pe s 65 , 6 1, 5 9, 4 7 D if fe re ... nd M ac D on al d , 1 98 4 7 al lo zy m e lo ci 29 5, 1 01 , 2 32 , 9 3, 3 59 ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Автор(ы): Jarman, S.N. and S. Nicol

7. Characteristics of seasonal variation in diurnal vertical migration and aggregation of Antarctic krill (Euphausia superba) in the Scotia Sea, using Japanese fishery data

   , T. Hayashi and M. Naganobu National Research Institute of Far Seas Fisheries 5-7-1 Orido, Shimizu ... level 3) × 5 / 6. Results Vertical distribution of trawling depth The average trawling depth in SS ... January, but decreased after February and was at its lowest level (0.17) from April to August (Figure 5 ... M TW SR S M RN DA Y AF T SS T ET W DS K NI T 0 5 10 15 20 25 Jan. 0 20 40 60 NIT DWN ...

   Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 163–172 : Автор(ы): Taki, K., T. Hayashi and M. Naganobu

8. Can we use discriminant function analysis to sex penguins prior to calculating an index of a morphometric characteristic?

   size required in order to be 80% certain of detecting the difference at the 5% level of significance ... ba = k(1l + aa) substituting equation (3) bA = l+kaA substituting equation (4) (5) We can ... and J.L' are widely separated or r is very small. 264 5. THE EFFECT OF SEX RATIO ON COMBINED ... % certain of detecting the difference between true and apparent means at 5% significance level (replicates ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 259–272 : Автор(ы): Agnew, D.J.

9. Krill population biology during the 1991 Chilean Antarctic krill fishery

   area approximately 40 x 40 m), which was towed at a mean velocity of 2.65 knots for 5 to 95 minutes ... the largest modes between 46 and 47 mm TL (Figure 5). The analysis of the size frequency ... 7 6 % F 5 r 9 4 q u3 e n ~~~ o_~"~·~e:m.,es c 2 y 1 20 23 26 29 32 35 38 41 44 47 ... ~fffffffffffffffffffffffffTfiTfiTfl11/ 20 23 26 29 32 35 38 41 44 47 50 53 56 Total length (mm) Figure 5: Size frequency ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 223–235 : Автор(ы): Mujica R., A., E. Acuña S. and A. Rivera O.

10. Estimating the impact of depredation by killer whales and sperm whales on longline fishing for toothfish (Dissostichus eleginoides) around South Georgia

    (Figure 5). In order to estimate the impact of cetacean dep- redation on total extractions, the declared ... , because the proportion of sets where they are present is between 3 and 5%. Over the seven years of study ... 66 9 4 67 1 4 67 1 20 05 3. 4% 5. 1% 8. 1% 3 05 7 3 16 0 3 21 3 3 ... 30 3 20 06 4. 2% 4. 9% 4. 4% 3 53 5 3 68 3 3 70 7 3 69 0 20 07 3. 8 ...

    Science Journal Paper : CCAMLR Science, Volume 17 (CCAMLR Science, Volume 17) : 163–178 : Автор(ы): Moir Clark, J. and D.J. Agnew

Страницы