Résultats de la recherche
-
A hybrid approach to acoustic classification and length estimation of krill
distribution. During the 1997/98 survey, 32 of 35 60-minute hauls contained euphausiids (Figure 1a and Table ... juveniles and sub-adults (around 12 and 20 mm) and two adult size classes (around 35 and 45 mm). However ... 1.5 1 1 1.5 r m r fj fi r m fj fi f k f a a f k a Δ . 35 Acoustic classifi cation and ... estimated confi dently in the interval (amin – amax) where 100|δ| < 20%, for a given dΔ. The mean length ...
Science Journal Paper : CCAMLR Science, Volume 11 (CCAMLR Science, Volume 11) : 33–58 : Auteur(s): Azzali, M., I. Leonori and G. Lanciani
-
Distribution characteristics of krill aggregations in the fishing ground off Coronation Island in the 1989/90 season
January. 63 ,-... 20 40 60 El SO '-" .£! 100 -P Pi ~ 120 ,-.,. 140 20 40 60 ... /green liver 15 - dark-green/green liver 65 20 40 60 1:30 10 19.12.89 - 7.0I.90r. time ... . .. ' .. . .. . ' . . " . . •• " .. # . . . . . " .. . .. . , 15' 67 20 40 60 80 100 ';:) 120 £:::; ~ ,.q 140 +l g.'160 ~ HlO ,,-.. 20 ... 68 (b) 29 January to 18 February 1990 Shaded area represents dawn and dusk 20 40 60 80 ...
Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/7 (Selected Scientific Papers, SC-CAMLR-SSP/7) : 49–73 : Auteur(s): Kasatkina, S.M. and V.I. Latogursky
-
Demographic characteristics of the Adélie penguin population on Béchervaise Island after 12 years of study
63 18 80 72 0 0. 38 19 99 / 00 37 31 18 36 99 0 0. 54 20 00 / 01 35 ... 17 36 34 0. 02 19 95 / 96 35 75 18 13 72 7 0. 40 19 96 / 97 38 42 ... gg ed (m in im um a ge 4 y ea rs ) 76 54 59 30 20 28 10 25 17 30 (a ) N um be rs ... % ) 7+ 35 (4 6% ) 29 (5 4% ) 35 (5 9% ) 18 (6 0% ) 15 (7 5% ) 22 (7 9 ...
Science Journal Paper : CCAMLR Science, Volume 10 (CCAMLR Science, Volume 10) : 53–74 : Auteur(s): Clarke, J., L.M. Emmerson, A. Townsend and K.R. Kerry
-
An impact assessment framework for bottom fishing methods in the CAMLR Convention Area
. 2 72 3. 0 24 0 00 17 .4 4 35 1 0. 40 0. 2 0. 08 0 T ot al s (i nc lu d ... °W 150 80° S 75° S 70° S 65° S 60° S 600-1800 200-600 60-200 20-60 7-20 2-7 NZ fishing effort ... fishing effort 600–1800 200–600 60–200 20–60 7–20 2–7 150 °E 160° E 170°E 180° 170°W 160°W 150°W ... kb on e 3 61 5. 2 1 3 61 5. 2 1 00 0 3. 62 4 35 1 0. 08 3 0. 05 0. 00 ...
Science Journal Paper : CCAMLR Science, Volume 16 (CCAMLR Science, Volume 16) : 195–210 : Auteur(s): Sharp, B.R., S.J. Parker and N. Smith
-
Low genetic diversity in the Antarctic toothfish (Dissostichus mawsoni) observed with mitochondrial and intron DNA markers
AGTATAAGCGTCTGGGTAGTC 60 72 2 Palumbi et al., 1991 CCAGAGATTAGAGGGAATCAGTG COII AAAGGGAGGAATTGAACCC 50 72 2 ... TGGCCTCTTCCTTTGGCCGTC 60 72 2 Chow and Hazama, 1998 AACTCGTCTGGCTTTTCGCC RP2 AGCGCCAAAATAGTGAAGCC 60 72 2 Chow ... performed in 20 μl volumes for a minimum of 4 h, following the manufacturer’s recommendations (New England ... CCGCTTAGYGCTTTGAAGGC ND3/4 AGTATAAGTGACTTCCAATCAC 50 72 2 Cronin et al., 1993 TTAGAATCACAATCTAATGTTTT COI ...
Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 43–51 : Auteur(s): Smith, P.J. and P.M. Gaffney
-
The Soviet krill fishery in the Atlantic Sector of the Antarctic from 1977 to 1991: fishing effort distribution and interannual patterns
00 6 3 63 4 19 90 37 4 85 6 35 0 21 3 27 3 40 9 27 2 75 1 4 20 9 19 91 ... 7 61 15 3 20 6 0 22 80 36 17 4 21 4 88 0 70 35 1 14 6 2. 3 B ... 79 38 6 25 6 32 1 34 4 34 9 82 5 32 1 19 6 4 51 6 19 80 47 7 18 6 35 6 ... 97 8 44 0 51 6 35 6 75 2 3 89 9 19 81 44 8 13 2 28 8 86 8 42 0 43 4 28 ...
Science Journal Paper : CCAMLR Science, Volume 10 (CCAMLR Science, Volume 10) : 1–13 : Auteur(s): Litvinov, F.F., V.A. Sushin, G.A. Chernega and O.A. Berezhinsky
-
Results of fish larvae sampling by means of fine-meshed samplers attached to a bottom trawl
bottom trawl Abstract / Description: Fine-meshed samplers were attached to the top of a bottom trawl in ... , more vulnerable to damage. The nets were more effective in sampling when attached to the top of the ... 0 34 2 0 2 2 35 50 66 60 38 36 1768 1220 240 288 37 1 2 0 4 0 38 6 2 0 1 0 45 38 20 74 58 46 ... 0 1 2 340 790 0 1 6 190 290 4 2 50 640 4 6 50 760 4 8 20 60 na - data not available 75 ... : 134 p. 73 Table 1: Station 19 20 22 24 25 26 30 31 32 33 34 35 36 37 38 45 ... 970 35 310 na 420 170 36 470 480 600 1200 37 420 na 170 500 38 100 330 1 0 140 45 20 70 420 300 ...
Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II (Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II) : 69-86 : Auteur(s): Ślósarczyk, W. and I. Wójcik
-
Analysis of albatross and petrel distribution within the CCAMLR Convention Area: results from the Global Procellariiform Tracking Database
for the estimation of distribution during the breeding season for all 20 albatross, petrel and ... importance of the Patagonian Shelf for top predator species breeding at South Georgia. Aquatic Conservation ... : Robertson, G. and R. Gales (Eds). Albatross Biology and Conservation. Surrey Beatty, Chipping Norton: 20 ... -browed albatross from the Kerguelen Islands and South Georgia (Figure 4); light-mantled albatross from ...
Science Journal Paper : CCAMLR Science, Volume 13 (CCAMLR Science, Volume 13) : 143–174 : Auteur(s): BirdLife International (prepared by C. Small and F. Taylor)
-
Effect of line sink rate on albatross mortality in the Patagonian toothfish longline fishery
. Sink rates to 4 m depth were greatest with 35 m (0.44 m/s) and 50 m (0.33 m/s) between weights. For ... -setting characteristics similar to the experimental vessel, this sink rate should be achievable with 4 kg ... 4 M 6 ~ n a c a ~ o i i B~ICOKOE npti HHTepsanax 35 M (0.44 M/c~K.) H 50 M (0.33 M/c~K.). Anx ... 4 m de profundidad fueron mayores cuando 10s pesos se colocaron a intervalos de 35 m (0,44 m/s) y ... rates to 4 m depth ranged from 0.44-0.1 m/s with weights at 35 and 200 m intervals respectively ... added to the distances shown). With 35 m weight spacing at 4 m depth, the longline would be 38 m ...
Science Journal Paper : CCAMLR Science, Volume 7 (CCAMLR Science, Volume 7) : 133–150 : Auteur(s): Robertson, G.G
-
Estimation of natural mortality for the Patagonian toothfish at Heard and McDonald Islands using catch-at-age and aged mark-recapture data from the main trawl ground
14 4 20 03 0 1 4 34 12 4 72 23 5 20 04 1 1 3 10 72 81 ... –5935 –5940 L M 43 Estimation of M for D. eleginoides at HIMI 0 20 40 60 0 20 40 60 Expected ... 0 20 40 60 5 10 15 20 1998 1999 5 10 15 20 2000 2001 2002 2003 2004 0 20 40 60 2005 0 ... 20 40 60 2006 5 10 15 20 2007 2008 Age N um be r r ec ap tu re s Candy et al. 44 ...
Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 29–45 : Auteur(s): Candy, S.G., D.C. Welsford, T. Lamb, J.J. Verdouw and J.J. Hutchins