Résultats de la recherche

1. Analysis of results from demersal fish surveys at South Georgia, undertaken by the United Kingdom and the USSR, January and February 1990

   (28) 12200 (28) 37 (73) 0 N. gibberifrons 12417 (28) 21891 (23) 267 (39) 0 N. rossii 1481 (76) 3915 ... and sample data. No age data were available because samples had not been fully analyzed. 224 3 ... series. All hauls were intended to last for 30 minutes at a speed of 3 to 3.5 knots. Hauls were ... towing speed was 3 to 3.5 knots over the ground. This was not always possible due to wind and tidal ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/7 (Selected Scientific Papers, SC-CAMLR-SSP/7) : 223–254 : Auteur(s): (Report of a Joint UK/USSR Workshop, 23 to 27 July 1990)

2. The use of patent databases to predict trends in the krill fishery

   351 patents have been lodged since 1999 (43% of all patents) as opposed to around 230 (28% of total ... Information, 28 (2): 147–158. Pilkington, A. 2004. Technology portfolio align- ment as an indicator of ... (Figures 3 to 5). Patents related to processing dominated applica- tions from the 1976 to 1986 period (50 ... . World Patent Information, 3 (1): 19–22. Darby, A. 2010. Australia selling whale prod- ucts in spite of ...

   Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 135–144 : Auteur(s): Foster, J., S. Nicol and S. Kawaguchi

3. Variations in echosounder calibration with temperature, and some possible implications for acoustic surveys of krill biomass

   ) split-beam transducers and a single-beam 200 kHz (200-28) transducer. To prevent damage by ice, the ... the water column between the 200 Simrad 200-28 Single 1 1 0.6 (long) 2.0 (narrow) 1 -20.9 ... x ~ o f i r eop rm AO a nocne caeMoK KpHnrr B TOM pafio~e H x a p a ~ ~ e p ~ 3 y e ~ c x s p e ... ~ P K T H K ~ AaHHblfi npu6op KaJIll6poBanI4 H B eBpone%cKog YaCTH YMepeHHbIX BOA. B 3 T H X 6onee ...

   Science Journal Paper : CCAMLR Science, Volume 5 (CCAMLR Science, Volume 5) : 273–281 : Auteur(s): Brierley, A.S., C. Goss, J.L. Watkins and P. Woodroffe

4. Can toothfish catches be used to predict the presence of vulnerable benthic invertebrate taxa?

   . Hydro- biologia, 471: 19–28. Hourigan, T.F., S.E. Lumsden, G. Dorr, A.W. Bruckner, S. Brooke and R.P ... . Document WG-EMM-10/28. CCAMLR, Hobart, Australia: 18 pp. SC-CAMLR. 2009. Report of the Workshop on ... 70° S 65° S 60° S 1 2 3 4 Figure 1: Ross Sea region indicating areas where segment-level ... 91 124 Segments with AXT 10 2 12 12 36 Segments with CSS 2 5 8 173 188 Segments with GGW 9 17 3 58 ...

   Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 87–96 : Auteur(s): Parker, S.J. and M.H. Smith

5. Evaluating the impact of multi-year research catch limits on overfished toothfish populations

   60 75 90 1 10 27 28 29 30 31 32 34 2 15 21 22 24 25 26 27 28 3 20 17 17 19* 20 21 22 23 4 25 15 16 ... , should aim to produce an as- sessment within a 3–4 year time frame of research commencing (SC-CAMLR ... stock within a 2–3 decade time frame and thus result in a failure to achieve the objectives of Article ... , SSB0 was 3 530 tonnes or ~71% of B0 in the simu- lated population. Ten years into the projection ...

   Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 47–55 : Auteur(s): Welsford, D.C

6. Guidelines for the preparation of hydroacoustic survey reports on krill

   /1Y 27-28/1Y 29/1Y-5/Y 6/Y - 172 - BNmeHHOCTHX, KOHTpOnbHHe TpaneHHH, npOMe- pO'IHHe pa60TH ... 12 16 20 24 28 32 36 40 r, I I I 1 r\1 I 1/ - ... 1 I \J I I~ I I I 1'\1/ V I I I ----i-"" I ... 3XOMeTpHqeCKHX HarrpaBJIeHa Ha rrOBbIllieHHe 33 e ~ OTQET 0 rH~POAKYCTHqECKOB CbEMKE ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/3 (Selected Scientific Papers, SC-CAMLR-SSP/3) : 165-193 : Auteur(s): Kalikhman, I.L.

7. Biomass, abundance and distribution of fish in the Kerguelen Islands EEZ (CCAMLR Statistical Division 58.5.1)

   catches comprised 63 fish species (two sharks, three skates, 28 near-bottom and 30 mid- water teleosts ... del área. Keywords: fish biomass, Kerguelen EEZ, Dissostichus eleginoides, CCAMLR 3 Biomass ... expectation of a survey of about 200 trawls. A minimum distance between stations of 5 n miles (3 n miles for ... South Skiff Bank Depth (m) 100–500 63 164 27 032 3 117* 500–1 000 38 540 46 965 3 755 Duhamel ...

   Science Journal Paper : CCAMLR Science, Volume 16 (CCAMLR Science, Volume 16) : 1–32 : Auteur(s): Duhamel, G. and M. Hautecoeur

8. Sources of variance in studies of krill population genetics

   Atlantic sector of Antarctic waters and off the Antarctic Peninsula. Polar Biol., 3: 19–28. Sundt, R.C ... nt ia ti on K üh l a nd S ch ne pp en he im , 1 98 6 8 al lo zy m e lo ci 28 4 ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Auteur(s): Jarman, S.N. and S. Nicol

9. On the intensity of sampling krill trawl catches

   Orkneys, and (b) Elephant Island. \0 E 28 100 £. « w 26 '" « fu 24 :r: 13 22 Z w ..... Z ... ~ ..... Figure 5: _ 30r 100\ (a) South Orkneys (b) Elephant island 1 28 3 ... Figures 2 and 3. Again significant differences were found between mean lengths by station at both the ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/7 (Selected Scientific Papers, SC-CAMLR-SSP/7) : 29–48 : Auteur(s): Miller, D.G.M.

10. Low genetic diversity in the Antarctic toothfish (Dissostichus mawsoni) observed with mitochondrial and intron DNA markers

    Pooled 110 34 1 0.89 0.48 0.88 Dyst6a genotypes SS 48 23 21 1 2.11 0.15 0.74 AAT 58 28 15 3 0.34 ... Antarctic Peninsula. Polar Biol., 3: 19–28. Shaw, P.W., A.I. Arkhipkin and H. Al-Khairulla. 2004. Genetic ... and Gaffney, 2000a). Twenty-four DNA templates of D. mawsoni (8 fi sh x 3 areas) were amplifi ed for ... , Hpa II, Rsa I and Taq I); a ~2.2 kb region encompassing NADH dehydrogenase sub-units 3/4L/4 was ...

    Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 43–51 : Auteur(s): Smith, P.J. and P.M. Gaffney

Pages