Search results

1. Biomass, abundance and distribution of fish in the Kerguelen Islands EEZ (CCAMLR Statistical Division 58.5.1)

   Bathyraja irrasa 8 968 3 355 4 233 69 875 Macrourus carinatus 6 508 2 181 2 815 24 676 Channichthys ... del área. Keywords: fish biomass, Kerguelen EEZ, Dissostichus eleginoides, CCAMLR 3 Biomass ... expectation of a survey of about 200 trawls. A minimum distance between stations of 5 n miles (3 n miles for ... from 6 September to 9 October 2006 (with two stations on 19 and 20 October 2006) in the whole area of ...

   Science Journal Paper : CCAMLR Science, Volume 16 (CCAMLR Science, Volume 16) : 1–32 : Author(s): Duhamel, G. and M. Hautecoeur

2. A simulation study of the method of deriving natural mortality rate using data for Champsocephalus gunnari in Subarea 48.3

   = 0.56; ak=6; Yk=8; at=3; a =36.85; f3 = 0.0113; q = 0.000115; (J r = 0.7008; P = 1000 (number of ... following values: Age group, a Sa Na,oxl0-6 1 0.0215 941.8 2 0.174 1216.3 3 0.692 ... 393.8 411.9 467.0 6 585.2 605.5 565.2 585.2 571.8 545.3 565.2 615.0 Table 3. Catch in weight and ... a,Y a,y Wa,y = (3) (4) For determination of regression equation parameters (2) both the ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/8 (Selected Scientific Papers, SC-CAMLR-SSP/8) : 69–83 : Author(s): Gasyukov, P.S. and R.S. Dorovskikh

3. Evaluation of the results of trawl selectivity experiments by Poland, Spain and USSR in 1978/79, 1981/82 and 1986/87

   small specimens of this species (Figures 5 and 6; see also Table 9.2 of the Appendix). 165 3 ... (80)(3) 3.22 28.0 22;32 15 - 52 2330 1841 241 2.5 6 110 (100)(4) 2.82 31.1 22-23 ;32-34 15 - 52 604 ... 3.41 23.19 172 159 22 19 -2 9 3.23 21.96 203 116 22 16 -3 6 3.20 21.74 157 109 23 1 9 -3 6 3.46 ... Figure 1: Figure 2: Figure 3: Figure 4: Figure 5: Figure 6: T a6JIHu,a 1: Ta6JIHu,a 2 ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/6 (Selected Scientific Papers, SC-CAMLR-SSP/6) : 163–196 : Author(s): Slosarczyk, W., E. Balguerias, K. Shust and S. Iglesias

4. Characteristics of seasonal variation in diurnal vertical migration and aggregation of Antarctic krill (Euphausia superba) in the Scotia Sea, using Japanese fishery data

   level 3) × 5 / 6. Results Vertical distribution of trawling depth The average trawling depth in SS ... June to September (Figure 3). Average diurnal trawling depth ranged from 6 to 24 m during December ... ETW DSK NIT 0 2 4 6 8 De pt h (m ) CP UE (g /m 3 ) Brightness categories Dec. Apr. Jan ... 2 0 8 6 4 2 0 8 6 4 2 0 20 16 12 8 4 0 D ep th (m ) C P U E (g /m 3 ) N ...

   Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 163–172 : Author(s): Taki, K., T. Hayashi and M. Naganobu

5. Notothenia (P.) guntheri stock status and TAC estimation in the area of Shag Rocks (Subarea 48.3)

   ,llOBaTeJIeM 6 0,900 1,0000 0,066 04005 011 736 0488 3. 1JllCJIeHHOCTb 1-0H B03pacTHoH rpynnbl BO BTOPOH npo ... 9630.10 146.50 8 T MJIH. (B Kr) TbIC. T MJIH. aK3 TbIC. T 1 2 3 4 5 6 0,900 0,900 ... 25,13 1,408 3HpyeMbJH ro,ll 3a,llaHa HCCJIe,llOBaTeJIeM 6 0,900 1,0000 0,066 15500 009 233 0108 3 ... ,llaHa HCCJIe,llOBaTeJIeM Table 1 Table 2 Table 3 Table 4 Table 5 Table 6 Table 7 Table ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II (Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II) : 53-68 : Author(s): Shust, K. and R. Borodin

6. Results of a longline survey on seamounts in the southeast Atlantic and in Subarea 48.6 and Division 58.4.4

   , BbICTaBJIRBIlIHXCR Ldpez Abellan and Gonzhlez Jimenez I I e p I l e H A H K y n X p H O H 3 0 6 a ~ a M Ha ... n b I K a q (Dissostichus eleginoides): 6b1no B b I n O B n e H O 2822 0 ~ 0 6 1 1 3 T 0 r 0 B ... 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Species Dissosticht~s ... /97 2/11/97 3/11/97 5/11/97 6/11/97 8/11/97 9/11/97 10/11/97 17/11/97 18/11/97 19/11/97 ...

   Science Journal Paper : CCAMLR Science, Volume 6 (CCAMLR Science, Volume 6) : 99–116 : Author(s): López Abellán, L.J. and J.F. González Jiménez

7. Distribution and population structure of Dissostichus eleginoides and D. mawsoni on BANZARE Bank (CCAMLR Division 58.4.3b), Indian Ocean.

   m al e M al e D . e le gi no id es 31 D ec –2 3 Fe b 20 06 /0 7 19 95 74 6 ... 4 32 0 12 6 11 4. 7 (1 7. 8) 10 6. 3 (1 4. 7) 59 –1 50 57 –1 50 0. 26 ( 0 ... 87 9 14 8. 1 (1 2. 2) 13 4. 6 (1 2. 8) 94 –1 90 90 –1 80 7. 8 (2 .7 ) 5. 3 ... 3 30 3 14 8. 6 (1 1. 3) 13 7. 3 (1 0. 5) 12 0– 18 5 11 0– 18 0 7. 9 (2 .3 ...

   Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 145–153 : Author(s): Taki, K., M. Kiyota, T. Ichii and T. Iwami

8. Can toothfish catches be used to predict the presence of vulnerable benthic invertebrate taxa?

   . 04 3 0. 00 2 60 P 0. 86 6 0. 08 9 0. 92 9 0. 02 6 0. 81 6 0. 13 9 0. 89 3 ... 0. 06 2 0. 91 2 0. 04 3 0. 86 9 0. 08 6 12 72 A ... 7 0. 73 4 0. 26 6 0. 87 5 0. 12 5 0. 68 8 0. 31 3 64 2 0. 93 8 0. 06 2 0 ... 41 7 3 0. 87 6 0. 12 4 0. 97 3 0. 02 7 0. 78 1 0. 21 9 0. 97 6 0. 02 4 0. 96 ...

   Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 87–96 : Author(s): Parker, S.J. and M.H. Smith

9. Sources of variance in studies of krill population genetics

   tD N A h ap lo ty pe s 70 , 6 8, 6 3, 4 8 D if fe re nt ia ti on M eg an yc ti ph ... , 1 44 , 1 44 , 9 3, 9 6, 1 44 , 9 6, 1 82 N o d if fe re nt ia ti on B uc kl in ... e t a l., 1 99 7 75 m tD N A h ap lo ty pe s* 14 , 1 2, 1 4, 1 3, 1 6, 1 8 ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Author(s): Jarman, S.N. and S. Nicol

10. Use of the Leslie stock depletion model for the assessment of local abundance of Patagonian toothfish (Dissostichus eleginoides)

    , 14, 15, 16, 17, 18, 20, 22 3, 9, 15, 19, 22 6, 10, 14 2, 8, 9, 12 Number of Data Series with ... a Negative Slope 12 15 6 8 2 6 2 3 Number of Data Series with a Significant Ne ative ... . Series 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 2 1 22 Table 6 ... -06 2.1E-06 -2.8E-06 2.5E-06 Series 1 2 3 4 5 6 7 8 9 10 11 12 1 3 14 15 16 ...

    Science Journal Paper : CCAMLR Science, Volume 3 (CCAMLR Science, Volume 3) : 55–77 : Author(s): Parkes, G., C.A. Moreno, G. Pilling and Z. Young

Pages