Home Home

CCAMLR

Commission for the Conservation of Antarctic Marine Living Resources

  • Home
  • Skip to Content
  • Log in

Search form

  • About CCAMLR
  • Conservation measures
  • Science
  • Fisheries
  • Compliance
  • Data
  • Meetings
  • Publications
  • Circulars
  • English
  • Français
  • Русский
  • Español
  • Home
  • Search
  • Search results
  • Site
  • 3到6岁动画片
  • Science Journal Paper
  • Site

Current search

Search found 396 items

  • 3到6岁动画片
  • (-) Science Journal Paper

Filter by content type:

  • (-) Science Journal Paper
Print this page
Increase font size
Decrease font size

Site

Advanced Search

Search results

  1. Biomass, abundance and distribution of fish in the Kerguelen Islands EEZ (CCAMLR Statistical Division 58.5.1)

    Bathyraja irrasa 8 968 3 355 4 233 69 875 Macrourus carinatus 6 508 2 181 2 815 24 676 Channichthys ... del área. Keywords: fish biomass, Kerguelen EEZ, Dissostichus eleginoides, CCAMLR 3 Biomass ... expectation of a survey of about 200 trawls. A minimum distance between stations of 5 n miles (3 n miles for ... from 6 September to 9 October 2006 (with two stations on 19 and 20 October 2006) in the whole area of ...

    Science Journal Paper : CCAMLR Science, Volume 16 (CCAMLR Science, Volume 16) : 1–32 : Author(s): Duhamel, G. and M. Hautecoeur

  2. A simulation study of the method of deriving natural mortality rate using data for Champsocephalus gunnari in Subarea 48.3

    = 0.56; ak=6; Yk=8; at=3; a =36.85; f3 = 0.0113; q = 0.000115; (J r = 0.7008; P = 1000 (number of ... following values: Age group, a Sa Na,oxl0-6 1 0.0215 941.8 2 0.174 1216.3 3 0.692 ... 393.8 411.9 467.0 6 585.2 605.5 565.2 585.2 571.8 545.3 565.2 615.0 Table 3. Catch in weight and ... a,Y a,y Wa,y = (3) (4) For determination of regression equation parameters (2) both the ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/8 (Selected Scientific Papers, SC-CAMLR-SSP/8) : 69–83 : Author(s): Gasyukov, P.S. and R.S. Dorovskikh

  3. Evaluation of the results of trawl selectivity experiments by Poland, Spain and USSR in 1978/79, 1981/82 and 1986/87

    small specimens of this species (Figures 5 and 6; see also Table 9.2 of the Appendix). 165 3 ... (80)(3) 3.22 28.0 22;32 15 - 52 2330 1841 241 2.5 6 110 (100)(4) 2.82 31.1 22-23 ;32-34 15 - 52 604 ... 3.41 23.19 172 159 22 19 -2 9 3.23 21.96 203 116 22 16 -3 6 3.20 21.74 157 109 23 1 9 -3 6 3.46 ... Figure 1: Figure 2: Figure 3: Figure 4: Figure 5: Figure 6: T a6JIHu,a 1: Ta6JIHu,a 2 ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/6 (Selected Scientific Papers, SC-CAMLR-SSP/6) : 163–196 : Author(s): Slosarczyk, W., E. Balguerias, K. Shust and S. Iglesias

  4. Characteristics of seasonal variation in diurnal vertical migration and aggregation of Antarctic krill (Euphausia superba) in the Scotia Sea, using Japanese fishery data

    level 3) × 5 / 6. Results Vertical distribution of trawling depth The average trawling depth in SS ... June to September (Figure 3). Average diurnal trawling depth ranged from 6 to 24 m during December ... ETW DSK NIT 0 2 4 6 8 De pt h (m ) CP UE (g /m 3 ) Brightness categories Dec. Apr. Jan ... 2 0 8 6 4 2 0 8 6 4 2 0 20 16 12 8 4 0 D ep th (m ) C P U E (g /m 3 ) N ...

    Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 163–172 : Author(s): Taki, K., T. Hayashi and M. Naganobu

  5. Notothenia (P.) guntheri stock status and TAC estimation in the area of Shag Rocks (Subarea 48.3)

    ,llOBaTeJIeM 6 0,900 1,0000 0,066 04005 011 736 0488 3. 1JllCJIeHHOCTb 1-0H B03pacTHoH rpynnbl BO BTOPOH npo ... 9630.10 146.50 8 T MJIH. (B Kr) TbIC. T MJIH. aK3 TbIC. T 1 2 3 4 5 6 0,900 0,900 ... 25,13 1,408 3HpyeMbJH ro,ll 3a,llaHa HCCJIe,llOBaTeJIeM 6 0,900 1,0000 0,066 15500 009 233 0108 3 ... ,llaHa HCCJIe,llOBaTeJIeM Table 1 Table 2 Table 3 Table 4 Table 5 Table 6 Table 7 Table ...

    Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II (Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II) : 53-68 : Author(s): Shust, K. and R. Borodin

  6. Results of a longline survey on seamounts in the southeast Atlantic and in Subarea 48.6 and Division 58.4.4

    , BbICTaBJIRBIlIHXCR Ldpez Abellan and Gonzhlez Jimenez I I e p I l e H A H K y n X p H O H 3 0 6 a ~ a M Ha ... n b I K a q (Dissostichus eleginoides): 6b1no B b I n O B n e H O 2822 0 ~ 0 6 1 1 3 T 0 r 0 B ... 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Species Dissosticht~s ... /97 2/11/97 3/11/97 5/11/97 6/11/97 8/11/97 9/11/97 10/11/97 17/11/97 18/11/97 19/11/97 ...

    Science Journal Paper : CCAMLR Science, Volume 6 (CCAMLR Science, Volume 6) : 99–116 : Author(s): López Abellán, L.J. and J.F. González Jiménez

  7. Distribution and population structure of Dissostichus eleginoides and D. mawsoni on BANZARE Bank (CCAMLR Division 58.4.3b), Indian Ocean.

    m al e M al e D . e le gi no id es 31 D ec –2 3 Fe b 20 06 /0 7 19 95 74 6 ... 4 32 0 12 6 11 4. 7 (1 7. 8) 10 6. 3 (1 4. 7) 59 –1 50 57 –1 50 0. 26 ( 0 ... 87 9 14 8. 1 (1 2. 2) 13 4. 6 (1 2. 8) 94 –1 90 90 –1 80 7. 8 (2 .7 ) 5. 3 ... 3 30 3 14 8. 6 (1 1. 3) 13 7. 3 (1 0. 5) 12 0– 18 5 11 0– 18 0 7. 9 (2 .3 ...

    Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 145–153 : Author(s): Taki, K., M. Kiyota, T. Ichii and T. Iwami

  8. Can toothfish catches be used to predict the presence of vulnerable benthic invertebrate taxa?

    . 04 3 0. 00 2 60 P 0. 86 6 0. 08 9 0. 92 9 0. 02 6 0. 81 6 0. 13 9 0. 89 3 ... 0. 06 2 0. 91 2 0. 04 3 0. 86 9 0. 08 6 12 72 A ... 7 0. 73 4 0. 26 6 0. 87 5 0. 12 5 0. 68 8 0. 31 3 64 2 0. 93 8 0. 06 2 0 ... 41 7 3 0. 87 6 0. 12 4 0. 97 3 0. 02 7 0. 78 1 0. 21 9 0. 97 6 0. 02 4 0. 96 ...

    Science Journal Paper : CCAMLR Science, Volume 18 (CCAMLR Science, Volume 18) : 87–96 : Author(s): Parker, S.J. and M.H. Smith

  9. Sources of variance in studies of krill population genetics

    tD N A h ap lo ty pe s 70 , 6 8, 6 3, 4 8 D if fe re nt ia ti on M eg an yc ti ph ... , 1 44 , 1 44 , 9 3, 9 6, 1 44 , 9 6, 1 82 N o d if fe re nt ia ti on B uc kl in ... e t a l., 1 99 7 75 m tD N A h ap lo ty pe s* 14 , 1 2, 1 4, 1 3, 1 6, 1 8 ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ...

    Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Author(s): Jarman, S.N. and S. Nicol

  10. Use of the Leslie stock depletion model for the assessment of local abundance of Patagonian toothfish (Dissostichus eleginoides)

    , 14, 15, 16, 17, 18, 20, 22 3, 9, 15, 19, 22 6, 10, 14 2, 8, 9, 12 Number of Data Series with ... a Negative Slope 12 15 6 8 2 6 2 3 Number of Data Series with a Significant Ne ative ... . Series 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 2 1 22 Table 6 ... -06 2.1E-06 -2.8E-06 2.5E-06 Series 1 2 3 4 5 6 7 8 9 10 11 12 1 3 14 15 16 ...

    Science Journal Paper : CCAMLR Science, Volume 3 (CCAMLR Science, Volume 3) : 55–77 : Author(s): Parkes, G., C.A. Moreno, G. Pilling and Z. Young

Pages

  • « first
  • ‹ previous
  • …
  • 7
  • 8
  • 9
  • 10
  • 11
  • 12
  • 13
  • 14
  • 15
  • …
  • next ›
  • last »

Contact us

Email: ccamlr [at] ccamlr [dot] org
Telephone: +61 3 6210 1111
Fax: +61 3 6224 8744
Address: 181 Macquarie Street, Hobart, 7000, Tasmania, Australia

 

Quick Links

  • Job vacancies
  • CCAMLR data forms
  • List of authorised vessels
  • Schedule of Conservation Measures in Force 2024/25

Recent and Upcoming Meetings

  • e-CDS
  • Log in
  • CCAMLR e-groups
  • CCAMLR Discussions
  • Support
  • Copyright
  • Disclaimer and Privacy Policy
  • Sitemap
  • Webmail
© Copyright - the Commission for the Conservation of Antarctic Marine Living Resources 2025, All rights reserved.  |  Top of page  |  Site by Eighty Options