Search results
-
Discrimination of Macrourus whitsoni and M. caml (Gadiformes, Macrouridae) using otolith morphometrics
study. SSRU M. whitsoni M. caml 881B 5 19 881C 61 48 881H 67 80 881J 4 19 881K 16 33 882H 67 ... total length (Figure 4) and fish age (Figure 5) but there was little change in otolith shape (roundness ... also larger than otoliths of M. whitsoni for fish of the same age (Figure 5). Otoliths of M. whitsoni ... morphometrics are given in Table 5. Discussion The spatial scale of the sampling used in this study was set ...
Science Journal Paper : CCAMLR Science, Volume 22 (CCAMLR Science, Volume 22) : 15–28 : Author(s): Pinkerton, M.H., C. Ó Maolagáin, J. Forman and P. Marriott
-
Abundance, size and maturity of krill (Euphausia superba) in the krill fishing ground of Subarea 48.1 during the 1990/91 austral summer
Institute of Far Seas Fisheries, Orido 5-7-1, Shimizu, Shizuoka, 424 Japan 183 184 tourbillons ... SUlVey Region Figure 5 shows the distribution of krill density along the transects. Krill density ... Neritic 10.3 28.1 47.3 15.9 289 5018 163 24 9 Nearshore 2.1 135.1 2020.6 124.8 284 8911 262 33 5 Total ... ' " \ II{-, \ • )'5\:'\:;:" '::ii;~ili:V ' ...... J \" ~~, \ ;I; .... ·::·.1:·: .. ,K ....... .-:11 ...
Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 183–199 : Author(s): Ichii, T., H. Ishii and M. Naganobu
-
The sensitivity of multiple output statistics to input parameters in a krill–predator–fishery ecosystem dynamics model
Matrix 1 18 5 90 1 Vector or matrix length is the number of relevant modelled areas, except for time ... s ji t j t j h sh j t j h sh v T Z v Z v ® ® ® = + - - - å å (5) is the number of ... perturbation-response combi- nations (Table 5). The perturbation produced a negative response (i.e. reduced ... 0.107 0.233 4 48.1 0.924 0.337 0.176 0.222 0.306 5 48.1 1.864 0.448 0.213 0.255 0.384 6 48.1 1.370 ...
Science Journal Paper : CCAMLR Science, Volume 20 (CCAMLR Science, Volume 20) : 97–118 : Author(s): Hill, S.L. and J. Matthews
-
The CCAMLR-2000 Krill Synoptic Survey: a description of the rationale and design
Far Sea Fisheries 5-7-1 Orido, Shimizu, Shizuoka, 424-8633, Japan V. Sushin and S.M. Kasatkina ... AtlantNIRO 5 Dmitry Donskoy Street Kaliningrad 236000, Russia S. Hedley Research Unit for Wildlife ... . The random sliifts for the grids are shown in Table 4. Table 5: Parameters used for the ... . Vessel Priority for Omission 1 2 3 4 5 6 7 8 9 10 Ship 1 (large-scale) Ship 2 (large-scale) Ship 2 ...
Science Journal Paper : CCAMLR Science, Volume 8 (CCAMLR Science, Volume 8) : 1–23 : Author(s): Trathan, P.N., J.L. Watkins, A.W.A. Murray, A.S. Brierley, I. Everson, C. Goss, J. Priddle, K. Reid, P. Ward, R. Hewitt, D. Demer, M. Naganobu, S. Kawaguchi, V. Sushin, S.M. Kasatkina, S. Hedley, S. Kim and T. Pauly
-
Surface water circulation in krill fishing areas near the South Shetland Islands
. Naganobu National Research Institute of Far Seas Fisheries 5-7-1, Orido, Shimizu, 424 Japan Abstract ... were re-calculated for each 5' latitude X 10' longitude block (5 X 5 n miles) for each month of the ... exhibited different patterns for these three regions (Figure l). Buoys 1 and 5 deployed in the oceanic ... northern shelf break. Buoys 1, 5 and 6 which travelled across the Scotia Sea to South Georgia and the ...
Science Journal Paper : CCAMLR Science, Volume 3 (CCAMLR Science, Volume 3) : 125–136 : Author(s): Ichii, T. and M. Naganobu
-
Sources of variance in studies of krill population genetics
reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ... an e t a l., 2 00 2 82 m tD N A h ap lo ty pe s 65 , 6 1, 5 9, 4 7 D if fe re ... nd M ac D on al d , 1 98 4 7 al lo zy m e lo ci 29 5, 1 01 , 2 32 , 9 3, 3 59 ...
Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Author(s): Jarman, S.N. and S. Nicol
-
Characteristics of seasonal variation in diurnal vertical migration and aggregation of Antarctic krill (Euphausia superba) in the Scotia Sea, using Japanese fishery data
, T. Hayashi and M. Naganobu National Research Institute of Far Seas Fisheries 5-7-1 Orido, Shimizu ... level 3) × 5 / 6. Results Vertical distribution of trawling depth The average trawling depth in SS ... January, but decreased after February and was at its lowest level (0.17) from April to August (Figure 5 ... M TW SR S M RN DA Y AF T SS T ET W DS K NI T 0 5 10 15 20 25 Jan. 0 20 40 60 NIT DWN ...
Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 163–172 : Author(s): Taki, K., T. Hayashi and M. Naganobu
-
Can we use discriminant function analysis to sex penguins prior to calculating an index of a morphometric characteristic?
size required in order to be 80% certain of detecting the difference at the 5% level of significance ... ba = k(1l + aa) substituting equation (3) bA = l+kaA substituting equation (4) (5) We can ... and J.L' are widely separated or r is very small. 264 5. THE EFFECT OF SEX RATIO ON COMBINED ... % certain of detecting the difference between true and apparent means at 5% significance level (replicates ...
Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 259–272 : Author(s): Agnew, D.J.
-
Krill population biology during the 1991 Chilean Antarctic krill fishery
area approximately 40 x 40 m), which was towed at a mean velocity of 2.65 knots for 5 to 95 minutes ... the largest modes between 46 and 47 mm TL (Figure 5). The analysis of the size frequency ... 7 6 % F 5 r 9 4 q u3 e n ~~~ o_~"~·~e:m.,es c 2 y 1 20 23 26 29 32 35 38 41 44 47 ... ~fffffffffffffffffffffffffTfiTfiTfl11/ 20 23 26 29 32 35 38 41 44 47 50 53 56 Total length (mm) Figure 5: Size frequency ...
Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 223–235 : Author(s): Mujica R., A., E. Acuña S. and A. Rivera O.
-
Results of fish larvae sampling by means of fine-meshed samplers attached to a bottom trawl
samples taken during the period 4 February-5 March 1986. In the bottom samples collected during this ... 320 0 612 40 280 2 514 1 0 180 0 128 1 0 560 5 2 1 0 170 0 32 4 320 6 2 na na 0 6 350 510 3 0 ... 0.505 mm mm X A B C 0 X A B C 0 19 0 0 20 0 612 21 * 5 22 2 514 23 0 0 24 0 128 25 5 2 26 0 ... 256 42 56 64 67 1 6 2 58 0 68 55 0 31 5 74 6 2 1 6 2 89 1 2 * 6 2 94 1 0 * 1 0 0 95 4 * 4 2 97 ...
Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II (Selected Scientific Papers, SC-CAMLR-SSP/5 – Part II) : 69-86 : Author(s): Ślósarczyk, W. and I. Wójcik