Search results

1. Acoustic estimates of krill density at South Georgia, 1981 to 1998

   CCAMLR Science, Vol. 6 (1999): 47-57 ACOUSTIC ESTIMATES ... Atkinson et al., 1999; Reid et al., 1999), and inclusion of differing proportions of such areas ... between the two areas (Brierley et al., 1999). More recently, however, Siege1 et al. (1998) have ... ends (Brandon et al., 1999). Observations of generally warmer waters in the western survey region ...

   Science Journal Paper : CCAMLR Science, Volume 6 (CCAMLR Science, Volume 6) : 47–57 : Author(s): Brierley, A.S., J.L. Watkins, C. Goss, M.T. Wilkinson and I. Everson

2. Preliminary analyses of data collected during experimental phases of the 1994/95 and 1995/96 Antarctic crab fishing seasons

   2's third depletion square. The assumptions of the mark-recapture model were probably violated ... area around Phase 2's third depletion square. The assumptions of the mark-recapture model were ... OnpeAeJIeHMR noKanb~0fi YMCneHHOCTM P. ~ p i n o s i ~ ~ i m a . BO~MOXHOCT~ HCIIOJlb30BaHMR ~IIpe~eJIll ... . B o61qe~, 3 ~ c n e p c r ~ e ~ ~ a n b ~ b r i i pemHM npoMbIcna o~a3ancx ycnemHbrM. B p e s y n ... e f i sh ing s ea sons ( sp l i t -years 1993/94 t o 1995/96) (CCAMLR, 1993) and has been ...

   Science Journal Paper : CCAMLR Science, Volume 4 (CCAMLR Science, Volume 4) : 141–159 : Author(s): Watters, G

3. A first attempt at an assessment of the Patagonian toothfish (Dissostichus eleginoides) resource in the Prince Edward Islands EEZ

   in the 1998/99 season, for example, are denoted as taken in 1999. Furthermore, the limited data available ... resources, for example for whales (see de la Mare, 1989 and Punt, 1999, for methodology), for tuna (e.g ... 2 818.9 1999 956.4 1 014 1 970.4 2000 1 558.7 1 210 2 768.7 2001 600.0 352 952.0 Total 7 047.2 25 ... 0.938 1999 0.842 2000 0.455 2001 0.164 Table 1: Estimates of IUU fishing in the Prince Edward Islands ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 11–32 : Author(s): Brandão, A., D.S. Butterworth, B.P. Watkins and D.G.M. Miller

4. Low breeding success of the Adélie penguin at Béchervaise Island in the 1998/99 season

   and Dyer, 1994; Croxall et al., 1999; van can be used as an indication of the status of lower Heezik ... of seabirds (Boersma et al., 1990; ~ roxa l l et al., 1999; van Heezik and Davis, 1990). Antarctic krill ... and Dyer, 1994; Croxall adeliae) and is also the subject of a major fishery et al., 1999), while others ... that take a narrow range (Nicol and Endo, 1999). Any species relying of prey items are prone to distress ...

   Science Journal Paper : CCAMLR Science, Volume 7 (CCAMLR Science, Volume 7) : 151–167 : Author(s): Irvine, L.G., J.R. Clarke and K.R. Kerry

5. Sexing of adult Adélie penguins by discriminant analysis of morphometric measurements

   been determined earlier by means of observing the birds' breeding behaviour (first incubation ... of Adelie penguins at Stranger Point (62°14'S, 58°40'W, King George/25 de Mayo Is., South Shetland ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/7 (Selected Scientific Papers, SC-CAMLR-SSP/7) : 543–549 : Author(s): Scolaro, J.A., Z.B. Stanganelli, H. Gallelli and D.F. Vergani

6. The biology, ecology and development of fishery management advice for the anomuran crabs at South Georgia (CCAMLR Subarea 48.3)

   1996 American Champion (USA) P. spinosissima 497 August 1999 (14 days) Argos Helena (GBR ... and Vinuesa, 1999) and enters the fishery at an approximate age of 15 years (Lovrich, 1997). Reproduction ... cycle. In the major- ity of species this process is seasonal (Lovrich and Vinuesa, 1999). Mating occurs ... . Detailed diet analysis of P. granulosa in the Beagle Channel, Tierra del Fuego (Comoglio and Amin, 1999 ...

   Science Journal Paper : CCAMLR Science, Volume 19 (CCAMLR Science, Volume 19) : 1–15 : Author(s): Belchier, M., T. Peatman and J. Brown

7. Patagonian toothfish in international waters of the Southwest Indian Ocean (Statistical Area 51)

   ; Sætersdal et al., 1999). The survey area does not represent the most appropriate location for recruitment ... Abellán and González Jiménez (1999), and migration from other areas. As Crozet (Is.) P. Edward Marion ... structure dominated by individuals of greater sizes (López Abellán and González Jiménez, 1999). Length ... and González Jiménez (1999) on Meteor Bank (8°30'E 48°S) and Ob (41°15'E 52°19'59"S) and Lena (44°15'E 53 ...

   Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 207–214 : Author(s): López Abellán, L.J

8. Analysis of variability of krill size and fish by-catch in the Japanese krill fishery based on scientific observer data

   1997 1999 2001 2003 2005 2007 Year 1995 1997 1999 2001 2003 ... 2005 2007 Year 1995 1997 1999 2001 2003 2005 2007 Le ng th ... variations within year (a−c), subarea (d) and vessel (e). Subarea 48.1 Year 1995 1997 1999 ... 50 0 (a) Subarea 48.1 Year 1995 1997 1999 2001 2003 2005 2007 N um ...

   Science Journal Paper : CCAMLR Science, Volume 19 (CCAMLR Science, Volume 19) : 31–47 : Author(s): Okuda, T. and M. Kiyota

9. Movement, growth and available abundance to the fishery of Dissostichus eleginoides Smitt, 1898 at Heard Island, derived from tagging experiments

   homogeneity can be maintained by a low level of interchange of fi sh. Agnew et al. (1999) inferred spawning ... (Constable et al., 1999). These assumptions have not been fully tested by investigating the general scale ... to 1 000 mm (Constable et al., 1999), as fi sh vulnerability at Heard Island decreases with length ... of the fi shery. The dome-shaped vulnerability functions estimated by Constable et al. (1999), and ap ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 33–48 : Author(s): Williams, R., G.N. Tuck, A.J. Constable and T. Lamb

10. Low genetic diversity in the Antarctic toothfish (Dissostichus mawsoni) observed with mitochondrial and intron DNA markers

    edited in CHROMAS (Technely- sium, Australia), and aligned in the BIOEDIT pro gram (Hall, 1999). Tests ... 7 (Quattro and Jones, 1999) with six enzymes (Dpn II, Hha I, Hpa II, Hpy188 I, HpyCH4 IV and Rsa ... ., 1999). Table 1: Mitochondrial DNA and intron primers evaluated with Dissostichus mawsoni. PCR ... 1 Quattro and Jones, 1999 CAGTCGGTCRGCRTTGGAGATGTC Gsyn TCCAACAGCGACATGTACCT 50 75 2 Chow, unpubl ...

    Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 43–51 : Author(s): Smith, P.J. and P.M. Gaffney

Pages